Strain Name:
C57BL/6J-MtgxR4152Btlr/Mmmh
Stock Number:
040996-MU
Citation ID:
RRID:MMRRC_040996-MU
Other Names:
R4152 (G1), C57BL/6J-MtgxR4152Btlr
Major Collection:

Gene Information

Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Upf1
Name: UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20564
Homologene: 2303
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21899
Homologene: 21223
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: E230024D05Rik, 9030416H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71521
Homologene: 22877
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Pabpc1
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabpl1, Pabp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18458
HGNC: HGNC:8554
Homologene: 37638
Gnb4
Name: guanine nucleotide binding protein (G protein), beta 4
Synonyms: 6720453A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14696
Homologene: 69140
Rab4b
Name: RAB4B, member RAS oncogene family
Synonyms: 1500031G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19342
HGNC: HGNC:9782
Homologene: 100632
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Prss14, Epithin, MT-SP1, matriptase, Tmprss14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19143
Homologene: 7906
Mavs
Name: mitochondrial antiviral signaling protein
Synonyms: IPS-1, D430028G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228607
Homologene: 17004
Pgk2
Name: phosphoglycerate kinase 2
Synonyms: Tcp-2, Tcp-2, Pgk-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18663
VEGA: 17
HGNC: HGNC:8898
Homologene: 57138
Akap6
Name: A kinase (PRKA) anchor protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Olfr835
Name: olfactory receptor 835
Synonyms: GA_x6K02T2PVTD-12771995-12772930, MOR150-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 257872
Homologene: 133702
Olfr965
Name: olfactory receptor 965
Synonyms: GA_x6K02T2PVTD-33416730-33417668, MOR171-28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258165
VEGA: 9
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627537
Homologene: 129750
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71096
Homologene: 56834
9530053A07Rik
Name: RIKEN cDNA 9530053A07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 319482
Homologene: 130055
Cdc16
Name: CDC16 cell division cycle 16
Synonyms: 2810431D22Rik, 2700071J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69957
HGNC: HGNC:1720
Homologene: 2899
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Slc5a3
Name: solute carrier family 5 (inositol transporters), member 3
Synonyms: Smit1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 53881
Homologene: 31412
Tspan15
Name: tetraspanin 15
Synonyms: 2700063A19Rik, Tm4sf15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70423
VEGA: 10
Homologene: 22716
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Col4a-1, Del(8)Bru44H, Del(8)44H, Bru, Svc, Raw, alpha1(IV) collagen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 632671
Vmn2r66
Name: vomeronasal 2, receptor 66
Synonyms: F830104D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233437
Homologene: 115466
Zc3h15
Name: zinc finger CCCH-type containing 15
Synonyms: FM22, Ierepo4, 1810012H02Rik, 1700006A17Rik, 2610312B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69082
Homologene: 10216
Nemp2
Name: nuclear envelope integral membrane protein 2
Synonyms: 5330401P04Rik, Tmem194b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227094
Homologene: 67089
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clc4-2, Clcn4-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Olfr690
Name: olfactory receptor 690
Synonyms: GA_x6K02T2PBJ9-7959171-7958224, MOR31-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56860
Homologene: 10653
Rsad1
Name: radical S-adenosyl methionine domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237926
Homologene: 41252
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Lpgat1
Name: lysophosphatidylglycerol acyltransferase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226856
Homologene: 8914
Tmem132a
Name: transmembrane protein 132A
Synonyms: 6720481D13Rik, Hspa5bp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 98170
Homologene: 75076
Prl8a2
Name: prolactin family 8, subfamily a, member 2
Synonyms: D/tPRP, DPRP, mdPRP, Dtprp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13529
Homologene: 49230
Gm6483
Name: predicted gene 6483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 624198
Snx31
Name: sorting nexin 31
Synonyms: 4631426E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66696
Homologene: 23551
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: mGk-16, Klk16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16615
HGNC: HGNC:6364
Homologene: 68141
Fam78b
Name: family with sequence similarity 78, member B
Synonyms: C030020L09Rik, C030014K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226610
Homologene: 18451
Vegfb
Name: vascular endothelial growth factor B
Synonyms: VEGF-B, Vrf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22340
Homologene: 87131
Gm26794
Name: predicted gene, 26794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 8,583,345 bp
  • C to T, chromosome 1 at 30,831,458 bp
  • A to G, chromosome 1 at 52,641,051 bp
  • T to C, chromosome 1 at 167,078,800 bp
  • C to A, chromosome 1 at 191,719,488 bp
  • A to G, chromosome 2 at 55,437,290 bp
  • T to C, chromosome 2 at 83,658,569 bp
  • A to G, chromosome 2 at 131,246,608 bp
  • A to G, chromosome 3 at 32,589,811 bp
  • T to C, chromosome 3 at 123,672,227 bp
  • A to C, chromosome 5 at 64,953,212 bp
  • A to T, chromosome 5 at 65,666,171 bp
  • A to G, chromosome 5 at 115,613,354 bp
  • T to A, chromosome 5 at 151,562,265 bp
  • T to C, chromosome 7 at 7,294,834 bp
  • T to C, chromosome 7 at 27,176,126 bp
  • T to A, chromosome 7 at 28,156,897 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 44,140,549 bp
  • A to G, chromosome 7 at 81,478,017 bp
  • T to C, chromosome 7 at 85,005,592 bp
  • T to C, chromosome 7 at 105,329,385 bp
  • T to C, chromosome 8 at 11,217,227 bp
  • A to G, chromosome 8 at 13,762,857 bp
  • T to C, chromosome 8 at 19,687,910 bp
  • C to T, chromosome 8 at 70,338,460 bp
  • T to A, chromosome 9 at 19,035,520 bp
  • T to C, chromosome 9 at 31,090,506 bp
  • A to C, chromosome 9 at 39,720,000 bp
  • G to A, chromosome 10 at 50,983,854 bp
  • A to T, chromosome 10 at 62,189,842 bp
  • A to G, chromosome 11 at 35,698,320 bp
  • T to G, chromosome 11 at 84,292,926 bp
  • T to C, chromosome 11 at 94,548,623 bp
  • A to C, chromosome 12 at 53,140,407 bp
  • T to C, chromosome 13 at 27,351,002 bp
  • G to A, chromosome 14 at 50,837,594 bp
  • T to C, chromosome 15 at 36,525,639 bp
  • G to A, chromosome 15 at 36,605,810 bp
  • T to A, chromosome 16 at 92,077,808 bp
  • AAAACAGGAGTATTGATTGGAAAC to AAAAC, chromosome 17 at 19,523,419 bp
  • A to G, chromosome 17 at 40,208,258 bp
  • G to T, chromosome 18 at 3,288,055 bp
  • G to A, chromosome 18 at 4,332,312 bp
  • T to C, chromosome 19 at 6,986,078 bp
  • A to G, chromosome 19 at 10,859,063 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4152 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040996-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.