Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4180Btlr/Mmmh
Stock Number:
041016-MU
Citation ID:
RRID:MMRRC_041016-MU
Other Names:
R4180 (G1), C57BL/6J-MtgxR4180Btlr
Major Collection:

Strain Information

Prkcd
Name: protein kinase C, delta
Synonyms: PKCdelta, PKC[d], Pkcd, D14Ertd420e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18753
HGNC: HGNC:9399
Homologene: 55963
Nub1
Name: negative regulator of ubiquitin-like proteins 1
Synonyms: BS4, NY-REN-18, 4931404D21Rik, 6330412F12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53312
Homologene: 41108
Chuk
Name: conserved helix-loop-helix ubiquitous kinase
Synonyms: Chuk1, IKK1, IKK[a], IKK-alpha, IkappaB kinase alpha, IKK 1, IKK alpha, IKKalpha, IKK-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12675
HGNC: HGNC:1974
Homologene: 979
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210925
VEGA: 14
Homologene: 10096
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: MLTKbeta, MLTKalpha, B230120H23Rik, Zak
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65964
Homologene: 32331
Tonsl
Name: tonsoku-like, DNA repair protein
Synonyms: 2810439M11Rik, Nfkbil2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72749
HGNC: HGNC:7801
Homologene: 22754
Klf4
Name: Kruppel-like transcription factor 4 (gut)
Synonyms: Zie, Gklf, EZF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16600
HGNC: HGNC:6348
Homologene: 3123
Mafa
Name: MAF bZIP transcription factor A
Synonyms: RIPE3b1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 378435
VEGA: 15
Homologene: 65867
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Glis2
Name: GLIS family zinc finger 2
Synonyms: Nkl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 83396
Homologene: 12821
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Zfp459
Name: zinc finger protein 459
Synonyms: 9930025G17Rik, Rslcan-14
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328274
Pak2
Name: p21 (RAC1) activated kinase 2
Synonyms: PAK-2, D16Ertd269e, A130002K10Rik, 5330420P17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224105
HGNC: HGNC:8591
Homologene: 99711
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Tgm5
Name: transglutaminase 5
Synonyms: 2310007C07Rik, TGx
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74176
Homologene: 20899
Itga9
Name: integrin alpha 9
Synonyms: 2610002H11Rik, D9Ertd428e, 6720458D17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Fam184b
Name: family with sequence similarity 184, member B
Synonyms: 9630031F12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 58227
Homologene: 137353
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Plekhg4
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms: 4931414L13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102075
Homologene: 18516
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Klf17
Name: Kruppel-like transcription factor 17
Synonyms: D4Ertd561e, 7420700M05Rik, Zfp393
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75753
Homologene: 12621
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Top2b
Name: topoisomerase (DNA) II beta
Synonyms: Top-2, D230016L12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21974
Homologene: 134711
Lhcgr
Name: luteinizing hormone/choriogonadotropin receptor
Synonyms: Lhr, Gpcr19-rs1, LH-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16867
VEGA: 17
HGNC: HGNC:6585
Homologene: 37276
Or1ak2
Name: olfactory receptor family 1 subfamily AK member 2
Synonyms: GA_x6K02T2NLDC-33631647-33632594, MOR134-1, Olfr356
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258617
Homologene: 85948
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: Abc2, D2H0S1474E
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Pdzrn4
Name: PDZ domain containing RING finger 4
Synonyms: SAMCAP3L, LNX4, 1110017D07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239618
VEGA: 15
Homologene: 85433
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93838
Homologene: 14143
Haus6
Name: HAUS augmin-like complex, subunit 6
Synonyms: D4Ertd27e, 6230416J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230376
Homologene: 9760
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Tuba4a
Name: tubulin, alpha 4A
Synonyms: M[a]4, Tuba4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22145
Homologene: 68496
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Bco2
Name: beta-carotene oxygenase 2
Synonyms: beta-diox-II, B-diox-II, CMO2, Bcdo2, Bcmo2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 170752
Homologene: 12912
Txnrd2
Name: thioredoxin reductase 2
Synonyms: ESTM573010, TR beta, TR3, TGR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26462
Homologene: 4701
Pkd2l1
Name: polycystic kidney disease 2-like 1
Synonyms: polycystin-L, Pkdl, PCL, TRPP3, PKD2L
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329064
HGNC: HGNC:9011
Homologene: 22946
Cd300lf
Name: CD300 molecule like family member F
Synonyms: Pigr3, CLM-1, IgSF13, IREM1, F730004D16Rik, DIgR2, LMIR3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246746
Homologene: 51396
Dpm3
Name: dolichyl-phosphate mannosyltransferase polypeptide 3
Synonyms: 1110001H19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68563
HGNC: HGNC:3007
Homologene: 17810
Idh3g
Name: isocitrate dehydrogenase 3 (NAD+), gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 15929
HGNC: HGNC:5386
Homologene: 55803
Trbv4
Name: T cell receptor beta, variable 10
Synonyms: Tcrb-V10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124660
Gm8587
Name: predicted pseudogene 8587
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 667350
Homologene: 133537
Gon7
Name: GON7 subunit of KEOPS complex
Synonyms: AK010878
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100233175
Homologene: 53430
Rgcc
Name: regulator of cell cycle
Synonyms: RGC-32, 1190002H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66214
Homologene: 8544
Zak
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,270,392 bp
  • T to C, chromosome 1 at 75,215,782 bp
  • T to C, chromosome 2 at 25,441,578 bp
  • T to A, chromosome 2 at 36,937,230 bp
  • A to G, chromosome 2 at 72,441,571 bp
  • A to T, chromosome 2 at 76,811,243 bp
  • T to C, chromosome 2 at 118,532,537 bp
  • T to C, chromosome 2 at 121,076,961 bp
  • A to G, chromosome 3 at 89,266,732 bp
  • C to T, chromosome 4 at 55,530,884 bp
  • A to T, chromosome 4 at 86,583,574 bp
  • A to G, chromosome 4 at 99,016,736 bp
  • T to A, chromosome 4 at 117,759,186 bp
  • T to A, chromosome 4 at 141,985,543 bp
  • T to G, chromosome 5 at 8,149,218 bp
  • T to C, chromosome 5 at 24,692,877 bp
  • T to C, chromosome 5 at 45,539,764 bp
  • A to C, chromosome 6 at 41,059,712 bp
  • T to C, chromosome 6 at 48,498,395 bp
  • A to G, chromosome 6 at 83,059,479 bp
  • G to A, chromosome 6 at 84,186,509 bp
  • T to C, chromosome 7 at 138,276,676 bp
  • T to A, chromosome 8 at 105,381,398 bp
  • T to C, chromosome 9 at 50,559,287 bp
  • T to C, chromosome 9 at 118,607,078 bp
  • T to C, chromosome 9 at 122,852,524 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • T to C, chromosome 11 at 115,124,263 bp
  • C to T, chromosome 12 at 88,089,746 bp
  • A to G, chromosome 12 at 101,665,695 bp
  • A to G, chromosome 12 at 102,754,104 bp
  • G to T, chromosome 13 at 67,408,443 bp
  • T to G, chromosome 14 at 16,409,189 bp
  • A to G, chromosome 14 at 30,610,304 bp
  • T to C, chromosome 14 at 64,992,981 bp
  • T to C, chromosome 14 at 79,300,715 bp
  • T to C, chromosome 15 at 75,747,564 bp
  • T to C, chromosome 15 at 76,180,215 bp
  • A to G, chromosome 15 at 76,624,475 bp
  • T to A, chromosome 15 at 92,402,017 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 4,611,376 bp
  • C to G, chromosome 16 at 18,426,425 bp
  • C to G, chromosome 16 at 32,052,187 bp
  • A to T, chromosome 16 at 37,247,880 bp
  • A to G, chromosome 17 at 88,742,283 bp
  • G to A, chromosome 19 at 44,101,840 bp
  • T to C, chromosome 19 at 44,192,181 bp
  • A to T, chromosome X at 73,782,004 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4180 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041016-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.