Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4249Btlr/Mmmh
Stock Number:
041065-MU
Citation ID:
RRID:MMRRC_041065-MU
Other Names:
R4249 (G1), C57BL/6J-MtgxR4249Btlr
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Atl3
Name: atlastin GTPase 3
Synonyms: 4633402C03Rik, 5730596K20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109168
VEGA: 19
Homologene: 9149
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Snx8
Name: sorting nexin 8
Synonyms: B130023O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231834
Homologene: 8338
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Zfp160
Name: zinc finger protein 160
Synonyms: 6720480D16Rik, 6720480D16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224585
VEGA: 17
Homologene: 137372
Sumf1
Name: sulfatase modifying factor 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58911
Homologene: 16268
Bcar1
Name: breast cancer anti-estrogen resistance 1
Synonyms: p130Cas, Cas, Crkas
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12927
HGNC: HGNC:971
Homologene: 7674
Glt1d1
Name: glycosyltransferase 1 domain containing 1
Synonyms: 5730455A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319804
Homologene: 16965
Phf13
Name: PHD finger protein 13
Synonyms: SPOC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230936
Homologene: 17822
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Ropn1
Name: ropporin, rhophilin associated protein 1
Synonyms: ropporin, 1700008N21Rik, RHPNAP1, ODF6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 76378
Homologene: 57119
Fcer2a
Name: Fc receptor, IgE, low affinity II, alpha polypeptide
Synonyms: low-affinity IgE receptor, FC epsilon RII, Fce2, Ly-42, CD23
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14128
HGNC: HGNC:3612
Homologene: 1517
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Or12d17
Name: olfactory receptor family 12 subfamily D member 17
Synonyms: GA_x6K02T2PSCP-1914078-1915022, MOR250-1, Olfr109
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258832
Homologene: 12811
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Aox2
Name: aldehyde oxidase 2
Synonyms: Aox3l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213043
Homologene: 84622
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232970
Homologene: 109375
Kansl1l
Name: KAT8 regulatory NSL complex subunit 1-like
Synonyms: C430010P07Rik, 1110028C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68691
Homologene: 27376
Col9a1
Name: collagen, type IX, alpha 1
Synonyms: Col9a-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12839
HGNC: HGNC:2217
Homologene: 1393
Hecw2
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms: D030049F17Rik, Nedl2, A730039N16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329152
Homologene: 66192
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Tubb1
Name: tubulin, beta 1 class VI
Synonyms: 2810484G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545486
Homologene: 69474
Slc22a27
Name: solute carrier family 22, member 27
Synonyms: mOAT6 related protein, AB056442
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 171405
Homologene: 77136
Trim5
Name: tripartite motif-containing 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667823
Homologene: 75345
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Gimd1
Name: GIMAP family P-loop NTPase domain containing 1
Synonyms: Gm5549
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433653
Homologene: 47516
Fbxw5
Name: F-box and WD-40 domain protein 5
Synonyms: Fbw5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30839
Homologene: 8496
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Lmtk3
Name: lemur tyrosine kinase 3
Synonyms: Aatyk3, AATYK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381983
Homologene: 79449
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
2700062C07Rik
Name: RIKEN cDNA 2700062C07 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68046
VEGA: 18
Homologene: 12230
Ankrd39
Name: ankyrin repeat domain 39
Synonyms: C030004B10Rik, 9130416N05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109346
Homologene: 9519
Samd11
Name: sterile alpha motif domain containing 11
Synonyms: mr-s
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 231004
VEGA: 4
Homologene: 34983
Satl1
Name: spermidine/spermine N1-acetyl transferase-like 1
Synonyms: 4930404K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 73809
Homologene: 28332
RP24-239E2.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Igkv2-116
Name: immunoglobulin kappa variable 2-116
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 434026
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,244,381 bp
  • A to G, chromosome 1 at 36,547,155 bp
  • C to T, chromosome 1 at 53,832,645 bp
  • A to G, chromosome 1 at 58,299,819 bp
  • C to T, chromosome 1 at 66,773,478 bp
  • A to G, chromosome 1 at 126,027,639 bp
  • C to A, chromosome 2 at 25,503,460 bp
  • A to T, chromosome 2 at 174,455,733 bp
  • T to C, chromosome 3 at 132,644,408 bp
  • A to T, chromosome 4 at 43,536,104 bp
  • A to T, chromosome 4 at 151,992,095 bp
  • G to A, chromosome 4 at 156,250,486 bp
  • A to G, chromosome 5 at 24,451,490 bp
  • A to G, chromosome 5 at 77,282,112 bp
  • T to C, chromosome 5 at 127,691,112 bp
  • A to G, chromosome 5 at 140,356,045 bp
  • A to G, chromosome 6 at 68,152,310 bp
  • A to C, chromosome 6 at 108,155,013 bp
  • T to A, chromosome 6 at 149,325,543 bp
  • T to C, chromosome 7 at 24,627,320 bp
  • C to A, chromosome 7 at 44,319,736 bp
  • G to A, chromosome 7 at 45,794,062 bp
  • T to A, chromosome 7 at 85,150,514 bp
  • C to G, chromosome 7 at 104,276,815 bp
  • A to G, chromosome 8 at 3,688,831 bp
  • T to C, chromosome 8 at 111,720,893 bp
  • CTGATGGTGGTGGTGATGGTGGTGG to CTGATGGTGGTGG, chromosome 8 at 121,604,292 bp
  • T to C, chromosome 9 at 99,101,176 bp
  • A to G, chromosome 10 at 33,450,998 bp
  • C to T, chromosome 11 at 8,865,543 bp
  • A to G, chromosome 11 at 55,284,301 bp
  • T to A, chromosome 14 at 26,709,186 bp
  • A to C, chromosome 14 at 61,203,457 bp
  • T to C, chromosome 16 at 32,755,826 bp
  • C to T, chromosome 16 at 34,678,456 bp
  • T to A, chromosome 17 at 21,025,738 bp
  • T to C, chromosome 17 at 37,466,824 bp
  • T to A, chromosome 17 at 71,092,140 bp
  • A to G, chromosome 17 at 84,586,337 bp
  • A to G, chromosome 18 at 24,472,956 bp
  • A to G, chromosome 18 at 24,990,066 bp
  • A to G, chromosome 19 at 6,315,266 bp
  • T to C, chromosome 19 at 7,532,338 bp
  • A to T, chromosome 19 at 7,925,879 bp
  • A to G, chromosome X at 112,406,336 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4249 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041065-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.