Strain Name:
Stock Number:
Citation ID:
Other Names:
R4301 (G1), C57BL/6J-MtgxR4301Btlr
Major Collection:

Strain Information

Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54446
Homologene: 4811
Name: cell division cycle 25A
Synonyms: D9Ertd393e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12530
Homologene: 1355
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239719
Homologene: 40917
Name: very low density lipoprotein receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22359
Homologene: 443
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70097
Homologene: 69182
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268783
Homologene: 10403
Name: fer (fms/fps related) protein kinase
Synonyms: Fert, C330004K01Rik, Fert2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14158
VEGA: 17
Homologene: 74300
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 83946
Homologene: 41209
Name: family with sequence similarity 193, member B
Synonyms: IRIZIO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 212483
VEGA: 13
Homologene: 130095
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 195018
Homologene: 9027
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 20658
Homologene: 10551
Name: eukaryotic translation elongation factor 1 alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13627
Homologene: 100799
Name: RAB37, member RAS oncogene family
Synonyms: B230331O03Rik, B230354I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 58222
Homologene: 23303
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20741
Homologene: 295
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70693
Homologene: 19235
Name: zinc finger and BTB domain containing 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229055
Homologene: 11395
Name: prickle planar cell polarity protein 1
Synonyms: 1110058P22Rik, mpk1, b2b019Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 106042
Homologene: 17686
Name: heat shock protein 1A
Synonyms: Hsp70.3, Hsp70-3, Hsp68, Hsp70a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 193740
Homologene: 74294
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170788
Homologene: 8092
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 667742
Homologene: 49695
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 621430
Homologene: 115466
Name: myopalladin
Synonyms: 1110056A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68802
VEGA: 10
Homologene: 23778
Name: zinc finger SWIM-type containing 8
Synonyms: 4832404P21Rik, 2310021P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268721
VEGA: 14
Homologene: 34313
Name: sorting nexin 14
Synonyms: YR-14, C330035N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244962
Homologene: 17823
Name: phosphoglucomutase 2
Synonyms: Pgm-1, 3230402E02Rik, Pgm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 66681
Homologene: 6693
Name: ataxin 7-like 1
Synonyms: 2810423G08Rik, Atxn7l4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380753
Homologene: 53366
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103406
Homologene: 88124
Name: ABI family member 3 binding protein
Synonyms: 5033411B22Rik, D930038M13Rik, eratin, TARSH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 320712
VEGA: 16
Homologene: 134172
Name: sialic acid acetylesterase
Synonyms: LSE, clone 165, Ysg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22619
Homologene: 8001
Name: olfactory receptor family 5 subfamily A member 3
Synonyms: GA_x6K02T2RE5P-2753221-2754177, MOR215-2, Olfr1441
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258678
Homologene: 17343
Name: ADAMTS-like 2
Synonyms: A930008K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77794
Homologene: 8798
Name: GDP-mannose pyrophosphorylase A
Synonyms: 1810012N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69080
Homologene: 8346
Name: coiled-coil domain containing 70
Synonyms: 1700112P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67929
Homologene: 12214
Name: protein phosphatase 2, regulatory subunit B, beta
Synonyms: 6330404L05Rik, PP2A-PR55B, PR55-BETA, SCA12, 2900026H06Rik, E130009M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72930
Homologene: 55833
Name: chitinase-like 4
Synonyms: Ym2, Chi3l4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 104183
Homologene: 74931
Name: leucine rich repeat containing 30
Synonyms: LOC240131
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240131
VEGA: 17
Homologene: 33184
Name: leucine zipper, putative tumor suppressor family member 3
Synonyms: Prosapip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241638
Homologene: 8824
Name: predicted gene 12473
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Name: RIKEN cDNA 2310040G07 gene
Synonyms: Gm16528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Name: microRNA 3968
Synonyms: mmu-mir-3968
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100628623
VEGA: 11
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,442,496 bp
  • A to G, chromosome 1 at 139,248,830 bp
  • A to G, chromosome 2 at 27,087,283 bp
  • A to G, chromosome 2 at 130,636,438 bp
  • A to T, chromosome 3 at 9,265,160 bp
  • G to A, chromosome 3 at 106,203,727 bp
  • T to C, chromosome 4 at 43,641,332 bp
  • T to C, chromosome 5 at 49,961,078 bp
  • G to A, chromosome 5 at 64,103,797 bp
  • G to T, chromosome 5 at 76,928,501 bp
  • A to G, chromosome 7 at 87,001,891 bp
  • T to C, chromosome 8 at 21,973,212 bp
  • T to C, chromosome 8 at 107,355,695 bp
  • C to A, chromosome 9 at 37,633,713 bp
  • T to A, chromosome 9 at 78,479,172 bp
  • G to A, chromosome 9 at 82,959,713 bp
  • A to T, chromosome 9 at 88,410,623 bp
  • T to C, chromosome 9 at 109,889,742 bp
  • A to G, chromosome 10 at 8,751,470 bp
  • A to G, chromosome 10 at 63,118,484 bp
  • T to C, chromosome 10 at 81,242,184 bp
  • T to C, chromosome 11 at 72,889,035 bp
  • T to A, chromosome 11 at 115,158,564 bp
  • T to C, chromosome 11 at 115,445,113 bp
  • A to G, chromosome 12 at 33,367,238 bp
  • A to G, chromosome 12 at 76,612,697 bp
  • G to A, chromosome 13 at 55,542,604 bp
  • G to A, chromosome 14 at 20,713,909 bp
  • T to A, chromosome 15 at 12,236,020 bp
  • T to C, chromosome 15 at 93,508,636 bp
  • T to C, chromosome 16 at 13,398,305 bp
  • T to A, chromosome 16 at 56,556,903 bp
  • A to G, chromosome 16 at 91,658,411 bp
  • T to C, chromosome 17 at 34,970,506 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 64,078,910 bp
  • A to G, chromosome 17 at 67,632,568 bp
  • T to A, chromosome 18 at 42,898,746 bp
  • T to C, chromosome 18 at 63,084,840 bp
  • T to C, chromosome 19 at 12,422,717 bp
  • T to C, chromosome 19 at 22,987,292 bp
  • C to A, chromosome 19 at 27,238,402 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4301 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041088-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.