Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4301Btlr/Mmmh
Stock Number:
041088-MU
Citation ID:
RRID:MMRRC_041088-MU
Other Names:
R4301 (G1), C57BL/6J-MtgxR4301Btlr
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Cdc25a
Name: cell division cycle 25A
Synonyms: D9Ertd393e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12530
HGNC: HGNC:1725
Homologene: 1355
Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Fer
Name: FER tyrosine kinase
Synonyms: Fert, C330004K01Rik, Fert2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,442,496 bp
  • A to G, chromosome 1 at 139,248,830 bp
  • A to G, chromosome 2 at 27,087,283 bp
  • A to G, chromosome 2 at 130,636,438 bp
  • A to T, chromosome 3 at 9,265,160 bp
  • G to A, chromosome 3 at 106,203,727 bp
  • T to C, chromosome 4 at 43,641,332 bp
  • T to C, chromosome 5 at 49,961,078 bp
  • G to A, chromosome 5 at 64,103,797 bp
  • G to T, chromosome 5 at 76,928,501 bp
  • A to G, chromosome 7 at 87,001,891 bp
  • T to C, chromosome 8 at 21,973,212 bp
  • T to C, chromosome 8 at 107,355,695 bp
  • C to A, chromosome 9 at 37,633,713 bp
  • T to A, chromosome 9 at 78,479,172 bp
  • G to A, chromosome 9 at 82,959,713 bp
  • A to T, chromosome 9 at 88,410,623 bp
  • T to C, chromosome 9 at 109,889,742 bp
  • A to G, chromosome 10 at 8,751,470 bp
  • A to G, chromosome 10 at 63,118,484 bp
  • T to C, chromosome 10 at 81,242,184 bp
  • T to C, chromosome 11 at 72,889,035 bp
  • T to A, chromosome 11 at 115,158,564 bp
  • T to C, chromosome 11 at 115,445,113 bp
  • A to G, chromosome 12 at 33,367,238 bp
  • A to G, chromosome 12 at 76,612,697 bp
  • G to A, chromosome 13 at 55,542,604 bp
  • G to A, chromosome 14 at 20,713,909 bp
  • T to A, chromosome 15 at 12,236,020 bp
  • T to C, chromosome 15 at 93,508,636 bp
  • T to C, chromosome 16 at 13,398,305 bp
  • T to A, chromosome 16 at 56,556,903 bp
  • A to G, chromosome 16 at 91,658,411 bp
  • T to C, chromosome 17 at 34,970,506 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 64,078,910 bp
  • A to G, chromosome 17 at 67,632,568 bp
  • T to A, chromosome 18 at 42,898,746 bp
  • T to C, chromosome 18 at 63,084,840 bp
  • T to C, chromosome 19 at 12,422,717 bp
  • T to C, chromosome 19 at 22,987,292 bp
  • C to A, chromosome 19 at 27,238,402 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4301 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041088-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.