Strain Name:
C57BL/6J-MtgxR4301Btlr/Mmmh
Stock Number:
041088-MU
Citation ID:
RRID:MMRRC_041088-MU
Other Names:
R4301 (G1), C57BL/6J-MtgxR4301Btlr
Major Collection:

Gene Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: TonEBP, nfatz, OREBP, B130038B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Cdc25a
Name: cell division cycle 25A
Synonyms: D9Ertd393e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12530
HGNC: HGNC:1725
Homologene: 1355
Mrtfb
Name: myocardin related transcription factor B
Synonyms: Mrtfb, Mkl2, Gt4-1, MRTF-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 239719
Homologene: 40917
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 22359
Homologene: 443
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70097
Homologene: 69182
Mtmr12
Name: myotubularin related protein 12
Synonyms: Pip3ap, C730015A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 268783
Homologene: 10403
Fer
Name: fer (fms/fps related) protein kinase
Synonyms: Fert2, C330004K01Rik, Fert
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 83946
Homologene: 41209
Fam193b
Name: family with sequence similarity 193, member B
Synonyms: IRIZIO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 212483
VEGA: 13
Homologene: 130095
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 195018
Homologene: 9027
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 20658
Homologene: 10551
Eef1a1
Name: eukaryotic translation elongation factor 1 alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 13627
HGNC: HGNC:3189
Homologene: 100799
Rab37
Name: RAB37, member RAS oncogene family
Synonyms: B230331O03Rik, B230354I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 58222
Homologene: 23303
Sptb
Name: spectrin beta, erythrocytic
Synonyms: spectrin R, brain erythroid spectrin (235E), LOC383567, Spnb-1, Spnb1, D330027P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20741
Homologene: 295
Adgra3
Name: adhesion G protein-coupled receptor A3
Synonyms: Gpr125, 3830613O22Rik, Tem5-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 70693
Homologene: 19235
Zbtb10
Name: zinc finger and BTB domain containing 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229055
Homologene: 11395
Prickle1
Name: prickle planar cell polarity protein 1
Synonyms: 1110058P22Rik, b2b019Clo, mpk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 106042
Homologene: 17686
Hspa1a
Name: heat shock protein 1A
Synonyms: Hsp70-3, Hsp70.3, Hsp68, Hsp70a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 193740
Homologene: 74294
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: 7530426H14Rik, A930008G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: Fam38b, Piezo2, 9030411M15Rik, Fam38b2, 9430028L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 667742
Homologene: 49695
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: LTRPC3, 6330504P12Rik, MLSN2, melastatin 2, B930001P07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226025
VEGA: 19
Homologene: 62287
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 621430
Homologene: 115466
Mypn
Name: myopalladin
Synonyms: 1110056A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 68802
VEGA: 10
Homologene: 23778
Zswim8
Name: zinc finger SWIM-type containing 8
Synonyms: 2310021P13Rik, 4832404P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 268721
VEGA: 14
Homologene: 34313
Snx14
Name: sorting nexin 14
Synonyms: C330035N22Rik, YR-14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 244962
Homologene: 17823
Pgm2
Name: phosphoglucomutase 2
Synonyms: 3230402E02Rik, Pgm1, Pgm-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 66681
HGNC: HGNC:8906
Homologene: 6693
Atxn7l1
Name: ataxin 7-like 1
Synonyms: Atxn7l4, 2810423G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 380753
Homologene: 53366
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 211468
Homologene: 14332
Zfr2
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 103406
Homologene: 88124
Abi3bp
Name: ABI gene family, member 3 (NESH) binding protein
Synonyms: TARSH, eratin, D930038M13Rik, 5033411B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 320712
VEGA: 16
Homologene: 134172
Siae
Name: sialic acid acetylesterase
Synonyms: Ysg2, clone 165, LSE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 22619
Homologene: 8001
Olfr1441
Name: olfactory receptor 1441
Synonyms: GA_x6K02T2RE5P-2753221-2754177, MOR215-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258678
Homologene: 17343
Adamtsl2
Name: ADAMTS-like 2
Synonyms: A930008K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 77794
Homologene: 8798
Gmppa
Name: GDP-mannose pyrophosphorylase A
Synonyms: 1810012N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 69080
Homologene: 8346
Ccdc70
Name: coiled-coil domain containing 70
Synonyms: 1700112P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 67929
Homologene: 12214
Ppp2r2b
Name: protein phosphatase 2, regulatory subunit B, beta
Synonyms: PR55-BETA, E130009M08Rik, 2900026H06Rik, SCA12, PP2A-PR55B, 6330404L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 72930
HGNC: HGNC:9305
Homologene: 55833
Chil4
Name: chitinase-like 4
Synonyms: Ym2, Chi3l4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 104183
Homologene: 74931
Lrrc30
Name: leucine rich repeat containing 30
Synonyms: LOC240131
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240131
VEGA: 17
Homologene: 33184
Lzts3
Name: leucine zipper, putative tumor suppressor family member 3
Synonyms: Prosapip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241638
Homologene: 8824
Gm12473
Name: predicted gene 12473
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
2310040G07Rik
Name: RIKEN cDNA 2310040G07 gene
Synonyms: Gm16528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
Mir3968
Name: microRNA 3968
Synonyms: mmu-mir-3968
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 100628623
VEGA: 11
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,442,496 bp
  • A to G, chromosome 1 at 139,248,830 bp
  • A to G, chromosome 2 at 27,087,283 bp
  • A to G, chromosome 2 at 130,636,438 bp
  • A to T, chromosome 3 at 9,265,160 bp
  • G to A, chromosome 3 at 106,203,727 bp
  • T to C, chromosome 4 at 43,641,332 bp
  • T to C, chromosome 5 at 49,961,078 bp
  • G to A, chromosome 5 at 64,103,797 bp
  • G to T, chromosome 5 at 76,928,501 bp
  • A to G, chromosome 7 at 87,001,891 bp
  • T to C, chromosome 8 at 21,973,212 bp
  • T to C, chromosome 8 at 107,355,695 bp
  • C to A, chromosome 9 at 37,633,713 bp
  • T to A, chromosome 9 at 78,479,172 bp
  • G to A, chromosome 9 at 82,959,713 bp
  • A to T, chromosome 9 at 88,410,623 bp
  • T to C, chromosome 9 at 109,889,742 bp
  • A to G, chromosome 10 at 8,751,470 bp
  • A to G, chromosome 10 at 63,118,484 bp
  • T to C, chromosome 10 at 81,242,184 bp
  • T to C, chromosome 11 at 72,889,035 bp
  • T to A, chromosome 11 at 115,158,564 bp
  • T to C, chromosome 11 at 115,445,113 bp
  • A to G, chromosome 12 at 33,367,238 bp
  • A to G, chromosome 12 at 76,612,697 bp
  • G to A, chromosome 13 at 55,542,604 bp
  • G to A, chromosome 14 at 20,713,909 bp
  • T to A, chromosome 15 at 12,236,020 bp
  • T to C, chromosome 15 at 93,508,636 bp
  • T to C, chromosome 16 at 13,398,305 bp
  • T to A, chromosome 16 at 56,556,903 bp
  • A to G, chromosome 16 at 91,658,411 bp
  • T to C, chromosome 17 at 34,970,506 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to T, chromosome 17 at 64,078,910 bp
  • A to G, chromosome 17 at 67,632,568 bp
  • T to A, chromosome 18 at 42,898,746 bp
  • T to C, chromosome 18 at 63,084,840 bp
  • T to C, chromosome 19 at 12,422,717 bp
  • T to C, chromosome 19 at 22,987,292 bp
  • C to A, chromosome 19 at 27,238,402 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4301 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041088-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.