Strain Name:
Stock Number:
Citation ID:
Other Names:
R4360 (G1), C57BL/6J-MtgxR4360Btlr
Major Collection:

Gene Information

Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74996
Homologene: 9929
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15525
Homologene: 1624
Name: serine/threonine kinase 4
Synonyms: Ysk3, Kas-2, Mst1, sterile 20-like kinase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58231
Homologene: 55965
Name: autophagy related 14
Synonyms: D14Ertd114e, D14Ertd436e, Barkor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 100504663
VEGA: 14
Homologene: 45423
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75553
VEGA: 12
Homologene: 32605
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20602
Homologene: 31370
Name: zinc finger protein 26
Synonyms: mkr-3, Zfp-26, 5033428C05Rik, Zfp70, KRAB15, Zfp81-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22688
Homologene: 52318
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 328417
Homologene: 124423
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabpl1, Pabp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18458
Homologene: 37638
Name: solute carrier family 18 (vesicular monoamine), member 3
Synonyms: VAChT, VAT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 20508
Homologene: 11022
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21923
Homologene: 55636
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70693
Homologene: 19235
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71389
Homologene: 32772
Name: serine carboxypeptidase 1
Synonyms: 2410018F01Rik, Risc, 4833411K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74617
Homologene: 41443
Name: STARD3 N-terminal like
Synonyms: 0610035N01Rik, 6530409L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76205
Homologene: 11501
Name: G2/M-phase specific E3 ubiquitin ligase
Synonyms: D930034K21Rik, 6030408C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217558
Homologene: 32362
Name: trans-acting transcription factor 8
Synonyms: mBtd, D930049B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320145
VEGA: 12
Homologene: 18548
Name: plakophilin 2
Synonyms: 1200012P04Rik, 1200008D14Rik, Pkp2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67451
Homologene: 3364
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: mtrp6, Trrp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22068
Homologene: 37944
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 77782
Homologene: 32727
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227334
Homologene: 32400
Name: flavin containing monooxygenase 2
Synonyms: 2310008D08Rik, 2310042I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 55990
Homologene: 86882
Name: FERM domain containing 4A
Synonyms: C230040M21Rik, 2700017I06Rik, Gm13190
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 209630
Homologene: 9971
Name: olfactory receptor 679
Synonyms: GA_x6K02T2PBJ9-7714499-7715446, MOR40-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259046
Homologene: 81538
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 435626
Homologene: 52359
Name: zinc finger protein 811
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240063
Name: casein alpha s2-like A
Synonyms: Csn1s2a, Csng
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12993
Homologene: 7284
Name: fumarylacetoacetate hydrolase
Synonyms: swst
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14085
Homologene: 110
Name: forkhead box G1
Synonyms: BF-1, Hfh9, Hfhbf1, Bf1, 2900064B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 15228
Homologene: 3843
Name: olfactory receptor 830
Synonyms: GA_x6K02T2PVTD-12618399-12619337, MOR152-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258559
Homologene: 79360
Name: sarcoglycan, epsilon
Synonyms: e-SG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20392
Homologene: 31205
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74682
Homologene: 10814
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
Synonyms: FAPP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 231999
Homologene: 32284
Name: heat shock protein 14
Synonyms: NST-1, 70kDa, HSP70L1, Hsp70-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 50497
Homologene: 74307
Name: PRAME like 16
Synonyms: Gm13109, Pramef25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329984
Homologene: 83161
Name: olfactory receptor 539
Synonyms: GA_x6K02T2PBJ9-42813436-42814368, MOR253-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258963
Homologene: 79393
Name: immunoglobulin superfamily containing leucine-rich repeat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 26968
Homologene: 4050
Name: tubulin folding cofactor B
Synonyms: 2410007D12Rik, Ckap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 66411
Homologene: 981
Name: predicted gene 1758
Synonyms: LOC385737
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Name: triggering receptor expressed on myeloid cells 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58218
VEGA: 17
Homologene: 87012
Name: cDNA sequence BC023105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 667597
VEGA: 18
Name: predicted gene 21972
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Name: predicted gene 829
Synonyms: LOC329839
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329839
Name: predicted pseudogene 3436
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100041622
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Name: predicted pseudogene 7204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 637273
VEGA: 16
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,147,663 bp
  • A to G, chromosome 1 at 86,133,737 bp
  • C to T, chromosome 1 at 87,952,361 bp
  • T to C, chromosome 1 at 162,882,014 bp
  • A to G, chromosome 2 at 3,502,523 bp
  • A to T, chromosome 2 at 4,601,241 bp
  • A to G, chromosome 2 at 160,949,856 bp
  • A to G, chromosome 2 at 164,088,959 bp
  • T to C, chromosome 4 at 45,718,819 bp
  • G to T, chromosome 4 at 64,016,924 bp
  • A to G, chromosome 4 at 143,950,863 bp
  • T to C, chromosome 5 at 49,990,210 bp
  • G to T, chromosome 5 at 87,781,841 bp
  • A to G, chromosome 5 at 125,028,972 bp
  • C to T, chromosome 6 at 4,707,265 bp
  • T to C, chromosome 6 at 54,622,186 bp
  • T to C, chromosome 7 at 30,227,035 bp
  • G to A, chromosome 7 at 84,589,648 bp
  • A to C, chromosome 7 at 105,086,253 bp
  • G to T, chromosome 7 at 112,054,932 bp
  • T to C, chromosome 7 at 140,667,817 bp
  • A to G, chromosome 9 at 8,610,266 bp
  • G to A, chromosome 9 at 18,875,717 bp
  • T to C, chromosome 9 at 20,438,573 bp
  • T to A, chromosome 9 at 58,157,604 bp
  • T to C, chromosome 9 at 70,852,582 bp
  • T to C, chromosome 11 at 53,265,092 bp
  • A to G, chromosome 11 at 88,930,244 bp
  • T to C, chromosome 12 at 8,974,149 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 12 at 49,384,692 bp
  • T to A, chromosome 12 at 51,363,414 bp
  • A to G, chromosome 12 at 98,780,197 bp
  • A to G, chromosome 12 at 118,848,665 bp
  • G to A, chromosome 13 at 19,370,484 bp
  • A to G, chromosome 14 at 32,463,925 bp
  • C to G, chromosome 14 at 47,568,370 bp
  • A to G, chromosome 14 at 56,629,204 bp
  • T to C, chromosome 14 at 66,938,401 bp
  • C to T, chromosome 15 at 36,605,465 bp
  • A to T, chromosome 16 at 14,506,351 bp
  • A to G, chromosome 16 at 16,268,682 bp
  • A to G, chromosome 16 at 37,060,339 bp
  • T to C, chromosome 16 at 48,218,833 bp
  • T to C, chromosome 17 at 32,798,458 bp
  • T to A, chromosome 17 at 48,249,773 bp
  • G to T, chromosome 18 at 60,442,001 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4360 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041111-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.