Strain Name:
C57BL/6J-MtgxR4400Btlr/Mmmh
Stock Number:
041131-MU
Citation ID:
RRID:MMRRC_041131-MU
Other Names:
R4400 (G1), C57BL/6J-MtgxR4400Btlr
Major Collection:

Strain Information

Matr3
Name: matrin 3
Synonyms: D030046F20Rik, 2810017I02Rik, 1110061A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17184
HGNC: HGNC:6912
Homologene: 7830
Ucp2
Name: uncoupling protein 2 (mitochondrial, proton carrier)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22228
Homologene: 2516
Elp3
Name: elongator acetyltransferase complex subunit 3
Synonyms: 2610507P14Rik, KAT9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74195
VEGA: 14
Homologene: 7105
Zranb3
Name: zinc finger, RAN-binding domain containing 3
Synonyms: 4933425L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226409
Homologene: 32770
Cog6
Name: component of oligomeric golgi complex 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67542
Homologene: 10802
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, D11Bwg0410e, Prp8, Sfprp8l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192159
Homologene: 4706
Git2
Name: GIT ArfGAP 2
Synonyms: Cool associated tyrosine phosphorylated-2, Cat-2, ARF GTPase activating protein 2, 5830420E16Rik, B230104M05Rik, 1500036H07Rik, 9630056M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Ubqln1
Name: ubiquilin 1
Synonyms: XDRP1, Dsk2, DA41, Plic-1, 1110046H03Rik, 1810030E05Rik, D13Ertd372e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56085
VEGA: 13
Homologene: 137258
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67772
Homologene: 72405
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Wdr76
Name: WD repeat domain 76
Synonyms: 5830411K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241627
Homologene: 38573
Mrtfa
Name: myocardin related transcription factor A
Synonyms: Mal, Bsac, MRTF-A, Mkl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223701
Homologene: 32487
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Shoc2
Name: Shoc2, leucine rich repeat scaffold protein
Synonyms: Sur-8, soc-2 (suppressor of clear) homolog (C. elegans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56392
VEGA: 19
Homologene: 7219
Fezf1
Name: Fez family zinc finger 1
Synonyms: Zfp312-like, Fez, 3110069A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 73191
Homologene: 19252
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319675
Homologene: 27936
Itgam
Name: integrin alpha M
Synonyms: complement component receptor 3 alpha, CD11B (p170), Mac-1 alpha, Mac-1, complement receptor type 3, CR3, CD11b/CD18, Mac-1a, F730045J24Rik, Ly-40, Cd11b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16409
HGNC: HGNC:6149
Homologene: 526
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Galnt2
Name: polypeptide N-acetylgalactosaminyltransferase 2
Synonyms: ppGaNTase-T2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 108148
HGNC: HGNC:4124
Homologene: 3297
Plpp2
Name: phospholipid phosphatase 2
Synonyms: Lpp2, Ppap2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 50784
HGNC: HGNC:9230
Homologene: 2752
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Tbx3
Name: T-box 3
Synonyms: D5Ertd189e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21386
Homologene: 4371
Tdrd7
Name: tudor domain containing 7
Synonyms: 5730495N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100121
Homologene: 8618
Trim60
Name: tripartite motif-containing 60
Synonyms: 2czf45, Rnf33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234329
Homologene: 51876
Or5ac23
Name: olfactory receptor family 5 subfamily AC member 23
Synonyms: GA_x54KRFPKG5P-55543875-55542958, MOR182-11P, Olfr205
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 257881
Homologene: 79469
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: Fbx12, E330009N23Rik, Fbxo12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 50757
Homologene: 110776
Plcl1
Name: phospholipase C-like 1
Synonyms: PLC-L, C230017K02Rik, PRIP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227120
HGNC: HGNC:9063
Homologene: 38155
Cd79b
Name: CD79B antigen
Synonyms: B29, Igb, Igbeta, Ig-beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15985
HGNC: HGNC:1699
Homologene: 521
Zxdc
Name: ZXD family zinc finger C
Synonyms: B930086F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 80292
Homologene: 82340
Or6b6
Name: olfactory receptor family 6 subfamily B member 6
Synonyms: GA_x6K02T2PBJ9-9352783-9351839, MOR103-4, Olfr711
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259037
Homologene: 128111
Mep1a
Name: meprin 1 alpha
Synonyms: meprin A alpha-subunit, meprin alpha, Mep-1a, Mep-1, Mep1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17287
HGNC: HGNC:7015
Homologene: 31323
Atp8a1
Name: ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Synonyms: Atp3a2, B230107D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11980
Homologene: 48402
Or14c39
Name: olfactory receptor family 14 subfamily C member 39
Synonyms: GA_x6K02T2NHDJ-9425121-9424195, MOR220-2, Olfr292
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258613
Homologene: 115526
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Ssrp1
Name: structure specific recognition protein 1
Synonyms: T160, Hmgi-rs3, Hmg1-rs1, Hmgox
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20833
Homologene: 110735
Stoml2
Name: stomatin (Epb7.2)-like 2
Synonyms: 0610038F01Rik, SLP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66592
Homologene: 8389
Asz1
Name: ankyrin repeat, SAM and basic leucine zipper domain containing 1
Synonyms: ORF3, 4933400N19Rik, Gasz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74068
HGNC: HGNC:1350
Homologene: 11374
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207777
Homologene: 37961
Gnrhr
Name: gonadotropin releasing hormone receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14715
HGNC: HGNC:4421
Homologene: 350
Hyal2
Name: hyaluronoglucosaminidase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15587
HGNC: HGNC:5321
Homologene: 7776
Atp4b
Name: ATPase, H+/K+ exchanging, beta polypeptide
Synonyms: H+,K+-ATPase, H,K-ATPase-Beta, H+/K+-ATPase beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11945
HGNC: HGNC:820
Homologene: 20182
Spopl
Name: speckle-type BTB/POZ protein-like
Synonyms: E430033K04Rik, 4921517N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76857
Homologene: 78016
Bves
Name: blood vessel epicardial substance
Synonyms: Popdc1, popeye 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 23828
VEGA: 10
HGNC: HGNC:1152
Homologene: 48497
Hoxd13
Name: homeobox D13
Synonyms: Hox-4.8, spdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15433
HGNC: HGNC:5136
Homologene: 20147
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 55,715,577 bp
  • A to C, chromosome 1 at 127,956,655 bp
  • C to T, chromosome 2 at 23,517,945 bp
  • A to T, chromosome 2 at 74,670,015 bp
  • A to T, chromosome 2 at 76,782,395 bp
  • A to T, chromosome 2 at 85,037,941 bp
  • A to G, chromosome 2 at 121,528,833 bp
  • A to C, chromosome 3 at 53,012,941 bp
  • A to G, chromosome 4 at 43,029,950 bp
  • T to C, chromosome 4 at 46,005,540 bp
  • G to A, chromosome 4 at 137,548,122 bp
  • A to G, chromosome 4 at 139,461,856 bp
  • A to T, chromosome 5 at 67,764,878 bp
  • T to C, chromosome 5 at 86,182,249 bp
  • T to C, chromosome 5 at 114,733,909 bp
  • G to T, chromosome 5 at 119,680,571 bp
  • A to G, chromosome 6 at 18,054,582 bp
  • T to C, chromosome 6 at 23,247,710 bp
  • G to A, chromosome 6 at 90,369,810 bp
  • A to G, chromosome 7 at 86,694,590 bp
  • A to G, chromosome 7 at 100,499,350 bp
  • A to G, chromosome 7 at 106,972,002 bp
  • T to G, chromosome 7 at 128,081,658 bp
  • A to G, chromosome 7 at 141,861,387 bp
  • A to G, chromosome 8 at 13,388,810 bp
  • G to T, chromosome 8 at 65,001,212 bp
  • A to G, chromosome 8 at 124,324,303 bp
  • A to G, chromosome 9 at 15,333,391 bp
  • A to G, chromosome 9 at 107,570,853 bp
  • A to T, chromosome 9 at 109,328,310 bp
  • T to C, chromosome 10 at 45,369,293 bp
  • A to G, chromosome 10 at 79,527,493 bp
  • A to G, chromosome 11 at 75,490,702 bp
  • T to C, chromosome 11 at 87,775,603 bp
  • A to T, chromosome 11 at 106,312,010 bp
  • A to T, chromosome 12 at 51,648,100 bp
  • T to A, chromosome 13 at 58,193,388 bp
  • A to T, chromosome 14 at 52,207,228 bp
  • C to T, chromosome 14 at 65,548,090 bp
  • G to A, chromosome 15 at 81,020,923 bp
  • C to T, chromosome 16 at 59,328,598 bp
  • T to A, chromosome 17 at 43,475,006 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 18 at 35,583,916 bp
  • A to G, chromosome 19 at 54,031,229 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4400 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041131-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.