Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4494Btlr/Mmmh
Stock Number:
041582-MU
Citation ID:
RRID:MMRRC_041582-MU
Other Names:
R4494 (G1), C57BL/6J-MtgxR4494Btlr
Major Collection:

Strain Information

Slc1a3
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 3
Synonyms: MGluT1, Eaat1, B430115D02Rik, GLAST, Gmt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20512
Homologene: 20882
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Chrna4
Name: cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms: alpha4 nAChR, Acra-4, Acra4, a4 nicotinic receptor, alpha4-nAChR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11438
HGNC: HGNC:1958
Homologene: 592
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76626
Homologene: 62199
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Slc25a26
Name: solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 26
Synonyms: 4930433D19Rik, 4933433F13Rik, D6Bwg0781e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67582
Homologene: 6834
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Ctbp1
Name: C-terminal binding protein 1
Synonyms: D4S115h, D5H4S115, BARS, D5H4S115E, CtBP1-S, CtBP1-L, CtBP3/BARS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13016
HGNC: HGNC:2494
Homologene: 1015
Atf7ip
Name: activating transcription factor 7 interacting protein
Synonyms: ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54343
Homologene: 10051
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Camsap1
Name: calmodulin regulated spectrin-associated protein 1
Synonyms: PRO2405, 9530003A05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227634
Homologene: 19202
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Calcr
Name: calcitonin receptor
Synonyms: Clr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12311
HGNC: HGNC:1440
Homologene: 1320
Cep63
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28135
Homologene: 11861
Efemp2
Name: epidermal growth factor-containing fibulin-like extracellular matrix protein 2
Synonyms: fibulin 4, MBP1, fibulin-4, 0610011K11Rik, Fbln4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58859
HGNC: HGNC:3219
Homologene: 32339
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Ddhd2
Name: DDHD domain containing 2
Synonyms: SAMWD1, 2010305K11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72108
Homologene: 66646
Nfkb2
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonyms: p52, NF kappaB2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18034
VEGA: 19
HGNC: HGNC:7795
Homologene: 1873
Ddr2
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18214
HGNC: HGNC:2731
Homologene: 68505
Chkb
Name: choline kinase beta
Synonyms: CK/EK-beta, Chetk, Chkl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12651
HGNC: HGNC:1938
Homologene: 88718
Cnbd1
Name: cyclic nucleotide binding domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435772
Homologene: 27843
Wdr89
Name: WD repeat domain 89
Synonyms: 2600001A11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72338
Homologene: 43791
Cryba2
Name: crystallin, beta A2
Synonyms: E130107M19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12958
HGNC: HGNC:2395
Homologene: 10991
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Synonyms: Kiaa0319
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210108
Homologene: 8878
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279029
Homologene: 19586
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Ccdc170
Name: coiled-coil domain containing 170
Synonyms: LOC237250, Gm221
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100504234
Homologene: 69393
Igsf11
Name: immunoglobulin superfamily, member 11
Synonyms: BT-IgSF, 1700025L02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207683
Homologene: 17613
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Hspa4l
Name: heat shock protein 4 like
Synonyms: APG-1, 94kDa, Osp94
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18415
Homologene: 22610
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Or4k47
Name: olfactory receptor family 4 subfamily K member 47
Synonyms: GA_x6K02T2Q125-72673494-72672556, MOR248-4, Olfr1297
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258890
Homologene: 115545
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
Plbd1
Name: phospholipase B domain containing 1
Synonyms: 1100001H23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66857
Homologene: 11745
Cr2
Name: complement receptor 2
Synonyms: CD21, CD35, Cr-1, Cr-2, Cr1, C3DR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Tas2r129
Name: taste receptor, type 2, member 129
Synonyms: T2R29, Tas2r29, mGR29, mt2r60
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387354
Homologene: 130074
Tent5a
Name: terminal nucleotidyltransferase 5A
Synonyms: D930050G01Rik, BAP014, Fam46a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 212943
Homologene: 23032
Krt75
Name: keratin 75
Synonyms: Krt2-6hf, 4732468K03Rik, Krtcap1, K6hf
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109052
Homologene: 20983
Cd177
Name: CD177 antigen
Synonyms: Pdp3, 1190003K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68891
Homologene: 49628
Tprn
Name: taperin
Synonyms: C430004E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 97031
Homologene: 52156
Prlhr
Name: prolactin releasing hormone receptor
Synonyms: LOC226278, PrRPR, GR3, Gpr10
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226278
VEGA: 19
HGNC: HGNC:4464
Homologene: 3134
Pimreg
Name: PICALM interacting mitotic regulator
Synonyms: 2610008F03Rik, CATS, 6720460F02Rik, Fam64a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 109212
Homologene: 10378
Prkra
Name: protein kinase, interferon inducible double stranded RNA dependent activator
Synonyms: RAX, Pact, PRK, lear
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23992
HGNC: HGNC:9438
Homologene: 2738
Kcnk18
Name: potassium channel, subfamily K, member 18
Synonyms: LOC332396, Tresk-2, Tresk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 332396
VEGA: 19
Homologene: 133808
Nme6
Name: NME/NM23 nucleoside diphosphate kinase 6
Synonyms: nm23-M6, non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54369
Homologene: 4231
Otud1
Name: OTU domain containing 1
Synonyms: 4933428L19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71198
Homologene: 45953
Naa60
Name: N(alpha)-acetyltransferase 60, NatF catalytic subunit
Synonyms: 1200013P24Rik, Nat15
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74763
Homologene: 32610
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,449,038 bp
  • A to G, chromosome 1 at 74,890,630 bp
  • C to A, chromosome 1 at 169,988,414 bp
  • C to T, chromosome 1 at 188,553,276 bp
  • T to C, chromosome 1 at 195,170,969 bp
  • C to T, chromosome 2 at 19,659,335 bp
  • T to C, chromosome 2 at 24,652,938 bp
  • T to C, chromosome 2 at 25,268,892 bp
  • T to C, chromosome 2 at 25,952,758 bp
  • A to G, chromosome 2 at 26,946,626 bp
  • C to A, chromosome 2 at 76,639,255 bp
  • A to G, chromosome 2 at 77,132,297 bp
  • T to A, chromosome 2 at 111,621,148 bp
  • T to A, chromosome 2 at 181,028,488 bp
  • T to C, chromosome 3 at 40,753,204 bp
  • A to G, chromosome 3 at 63,347,192 bp
  • C to G, chromosome 3 at 64,275,271 bp
  • A to G, chromosome 3 at 87,976,813 bp
  • A to G, chromosome 3 at 103,585,630 bp
  • T to A, chromosome 4 at 19,098,150 bp
  • T to C, chromosome 5 at 33,250,869 bp
  • T to A, chromosome 5 at 109,428,469 bp
  • T to C, chromosome 5 at 114,045,627 bp
  • T to C, chromosome 5 at 115,873,984 bp
  • A to T, chromosome 6 at 3,708,484 bp
  • A to G, chromosome 6 at 68,437,796 bp
  • A to G, chromosome 6 at 94,598,403 bp
  • G to A, chromosome 6 at 125,655,036 bp
  • A to G, chromosome 6 at 132,951,354 bp
  • T to A, chromosome 6 at 136,563,749 bp
  • T to C, chromosome 6 at 136,613,858 bp
  • A to T, chromosome 7 at 24,752,003 bp
  • C to T, chromosome 7 at 80,359,275 bp
  • A to G, chromosome 8 at 25,738,234 bp
  • G to A, chromosome 8 at 120,570,814 bp
  • A to G, chromosome 9 at 85,325,047 bp
  • A to G, chromosome 9 at 102,602,587 bp
  • C to T, chromosome 9 at 109,842,054 bp
  • T to C, chromosome 10 at 4,514,128 bp
  • T to C, chromosome 11 at 72,045,138 bp
  • T to C, chromosome 11 at 88,717,359 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to T, chromosome 12 at 75,632,747 bp
  • T to C, chromosome 12 at 113,597,584 bp
  • T to C, chromosome 13 at 9,571,062 bp
  • G to A, chromosome 13 at 13,635,383 bp
  • C to T, chromosome 13 at 24,871,356 bp
  • C to T, chromosome 14 at 26,871,855 bp
  • G to A, chromosome 15 at 8,639,095 bp
  • C to T, chromosome 15 at 89,419,075 bp
  • A to T, chromosome 15 at 101,571,701 bp
  • T to A, chromosome 16 at 3,900,721 bp
  • T to G, chromosome 16 at 39,011,341 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to A, chromosome 19 at 5,480,311 bp
  • A to G, chromosome 19 at 46,308,439 bp
  • T to C, chromosome 19 at 59,234,831 bp
  • A to T, chromosome 19 at 60,467,081 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4494 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041582-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.