Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4494Btlr/Mmmh
Stock Number:
041582-MU
Citation ID:
RRID:MMRRC_041582-MU
Other Names:
R4494 (G1), C57BL/6J-MtgxR4494Btlr
Major Collection:

Strain Information

Slc1a3
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 3
Synonyms: MGluT1, Eaat1, B430115D02Rik, GLAST, Gmt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20512
Homologene: 20882
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Chrna4
Name: cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms: alpha4 nAChR, Acra-4, Acra4, a4 nicotinic receptor, alpha4-nAChR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11438
HGNC: HGNC:1958
Homologene: 592
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76626
Homologene: 62199
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,449,038 bp
  • A to G, chromosome 1 at 74,890,630 bp
  • C to A, chromosome 1 at 169,988,414 bp
  • C to T, chromosome 1 at 188,553,276 bp
  • T to C, chromosome 1 at 195,170,969 bp
  • C to T, chromosome 2 at 19,659,335 bp
  • T to C, chromosome 2 at 24,652,938 bp
  • T to C, chromosome 2 at 25,268,892 bp
  • T to C, chromosome 2 at 25,952,758 bp
  • A to G, chromosome 2 at 26,946,626 bp
  • C to A, chromosome 2 at 76,639,255 bp
  • A to G, chromosome 2 at 77,132,297 bp
  • T to A, chromosome 2 at 111,621,148 bp
  • T to A, chromosome 2 at 181,028,488 bp
  • T to C, chromosome 3 at 40,753,204 bp
  • A to G, chromosome 3 at 63,347,192 bp
  • C to G, chromosome 3 at 64,275,271 bp
  • A to G, chromosome 3 at 87,976,813 bp
  • A to G, chromosome 3 at 103,585,630 bp
  • T to A, chromosome 4 at 19,098,150 bp
  • T to C, chromosome 5 at 33,250,869 bp
  • T to A, chromosome 5 at 109,428,469 bp
  • T to C, chromosome 5 at 114,045,627 bp
  • T to C, chromosome 5 at 115,873,984 bp
  • A to T, chromosome 6 at 3,708,484 bp
  • A to G, chromosome 6 at 68,437,796 bp
  • A to G, chromosome 6 at 94,598,403 bp
  • G to A, chromosome 6 at 125,655,036 bp
  • A to G, chromosome 6 at 132,951,354 bp
  • T to A, chromosome 6 at 136,563,749 bp
  • T to C, chromosome 6 at 136,613,858 bp
  • A to T, chromosome 7 at 24,752,003 bp
  • C to T, chromosome 7 at 80,359,275 bp
  • A to G, chromosome 8 at 25,738,234 bp
  • G to A, chromosome 8 at 120,570,814 bp
  • A to G, chromosome 9 at 85,325,047 bp
  • A to G, chromosome 9 at 102,602,587 bp
  • C to T, chromosome 9 at 109,842,054 bp
  • T to C, chromosome 10 at 4,514,128 bp
  • T to C, chromosome 11 at 72,045,138 bp
  • T to C, chromosome 11 at 88,717,359 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to T, chromosome 12 at 75,632,747 bp
  • T to C, chromosome 12 at 113,597,584 bp
  • T to C, chromosome 13 at 9,571,062 bp
  • G to A, chromosome 13 at 13,635,383 bp
  • C to T, chromosome 13 at 24,871,356 bp
  • C to T, chromosome 14 at 26,871,855 bp
  • G to A, chromosome 15 at 8,639,095 bp
  • C to T, chromosome 15 at 89,419,075 bp
  • A to T, chromosome 15 at 101,571,701 bp
  • T to A, chromosome 16 at 3,900,721 bp
  • T to G, chromosome 16 at 39,011,341 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to A, chromosome 19 at 5,480,311 bp
  • A to G, chromosome 19 at 46,308,439 bp
  • T to C, chromosome 19 at 59,234,831 bp
  • A to T, chromosome 19 at 60,467,081 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4494 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041582-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.