Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3900Btlr/Mmmh
Stock Number:
041607-MU
Citation ID:
RRID:MMRRC_041607-MU
Other Names:
R3900 (G1), C57BL/6J-MtgxR3900Btlr
Major Collection:

Strain Information

Prkar1a
Name: protein kinase, cAMP dependent regulatory, type I, alpha
Synonyms: Tse-1, Tse1, 1300018C22Rik, RIalpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19084
HGNC: HGNC:9388
Homologene: 37664
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Srrm1
Name: serine/arginine repetitive matrix 1
Synonyms: SRm160
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 51796
Eif2ak4
Name: eukaryotic translation initiation factor 2 alpha kinase 4
Synonyms: GCN2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27103
Homologene: 40891
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Brpf1
Name: bromodomain and PHD finger containing, 1
Synonyms: 4930540D11Rik, 4833438B11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78783
Homologene: 31251
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Bcl6
Name: B cell leukemia/lymphoma 6
Synonyms: Bcl5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12053
HGNC: HGNC:1001
Homologene: 7640
Mrgpra1
Name: MAS-related GPR, member A1
Synonyms: MrgA1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233221
Homologene: 79615
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Gm10615
Name: predicted gene 10615
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100038739
VEGA: 9
Timp2
Name: tissue inhibitor of metalloproteinase 2
Synonyms: TIMP-2, Timp-2, D11Bwg1104e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21858
Homologene: 2444
Igsf9
Name: immunoglobulin superfamily, member 9
Synonyms: NRT1, Dasm1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93842
Homologene: 10815
Wdr6
Name: WD repeat domain 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83669
Homologene: 117682
Sec63
Name: SEC63 homolog, protein translocation regulator
Synonyms: 5730478J10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140740
Homologene: 5220
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Fchsd2
Name: FCH and double SH3 domains 2
Synonyms: Sh3md3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207278
Homologene: 8887
Elfn1
Name: leucine rich repeat and fibronectin type III, extracellular 1
Synonyms: A930017N06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243312
Homologene: 18465
Anpep
Name: alanyl aminopeptidase, membrane
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Mmrn2
Name: multimerin 2
Synonyms: EndoGlyx-1, ENDOGLYX1, Emilin3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105450
VEGA: 14
Homologene: 11697
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Trim69
Name: tripartite motif-containing 69
Synonyms: 4921519C19Rik, Trif, Rnf36
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70928
Homologene: 18827
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
AI182371
Name: expressed sequence AI182371
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98870
Homologene: 87268
Slc24a1
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214111
VEGA: 9
Homologene: 3472
Rd3
Name: retinal degeneration 3
Synonyms: rd-3, 3322402L07Rik, rd3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74023
Homologene: 11373
Csgalnact2
Name: chondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms: 4632415D10Rik, Galnact2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78752
Homologene: 23109
Apc2
Name: APC regulator of WNT signaling pathway 2
Synonyms: APCL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23805
Homologene: 4299
Slc22a18
Name: solute carrier family 22 (organic cation transporter), member 18
Synonyms: TSSC5, IMPT1, BWSCR1A, Orctl2, Impt1, p45-BWR1A, BWR1A, Slc22a1l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18400
Homologene: 1918
Dusp10
Name: dual specificity phosphatase 10
Synonyms: MKP-5, 2610306G15Rik, MKP5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63953
HGNC: HGNC:3065
Homologene: 5215
Cherp
Name: calcium homeostasis endoplasmic reticulum protein
Synonyms: 5730408I11Rik, SCAF6, DAN16, D8Wsu96e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 27967
Homologene: 4656
Gm6133
Name: predicted gene 6133
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 620155
VEGA: 18
Usp36
Name: ubiquitin specific peptidase 36
Synonyms: 2700002L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72344
Homologene: 11828
Ubash3b
Name: ubiquitin associated and SH3 domain containing, B
Synonyms: 2810457I06Rik, TULA-2, Sts-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72828
Homologene: 13152
Otud3
Name: OTU domain containing 3
Synonyms: 3110030K17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73162
Homologene: 66103
Or8g2b
Name: olfactory receptor family 8 subfamily G member 2B
Synonyms: GA_x6K02T2PVTD-33539896-33540819, MOR171-13, Olfr971
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258607
VEGA: 9
Homologene: 133635
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Smoc1
Name: SPARC related modular calcium binding 1
Synonyms: SPARC-related protein, SRG, 2600002F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 64075
Homologene: 56943
Zfp248
Name: zinc finger protein 248
Synonyms: E130106N01Rik, 2810037F07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72720
Homologene: 69325
Or4c11b
Name: olfactory receptor family 4 subfamily C member 11B
Synonyms: GA_x6K02T2Q125-50268830-50269753, MOR230-2, Olfr1201
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258897
Homologene: 81567
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 172,489,558 bp
  • T to C, chromosome 1 at 184,074,250 bp
  • T to C, chromosome 1 at 191,985,256 bp
  • C to A, chromosome 2 at 13,286,980 bp
  • T to C, chromosome 2 at 35,085,216 bp
  • A to T, chromosome 2 at 88,794,929 bp
  • A to G, chromosome 2 at 118,475,029 bp
  • A to G, chromosome 2 at 120,713,549 bp
  • A to G, chromosome 2 at 122,178,841 bp
  • G to A, chromosome 3 at 59,227,668 bp
  • A to T, chromosome 4 at 135,321,466 bp
  • T to C, chromosome 4 at 138,896,885 bp
  • T to C, chromosome 4 at 139,479,062 bp
  • G to A, chromosome 5 at 139,971,964 bp
  • A to G, chromosome 6 at 113,318,433 bp
  • A to T, chromosome 6 at 118,121,014 bp
  • T to C, chromosome 6 at 118,429,566 bp
  • G to T, chromosome 7 at 47,335,527 bp
  • A to G, chromosome 7 at 79,839,225 bp
  • A to G, chromosome 7 at 101,191,799 bp
  • C to A, chromosome 7 at 143,479,770 bp
  • A to G, chromosome 8 at 72,469,936 bp
  • A to G, chromosome 9 at 39,839,402 bp
  • C to T, chromosome 9 at 41,031,564 bp
  • A to T, chromosome 9 at 64,928,144 bp
  • G to A, chromosome 9 at 108,575,769 bp
  • T to C, chromosome 9 at 110,118,518 bp
  • C to T, chromosome 9 at 110,592,518 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • T to A, chromosome 10 at 42,789,286 bp
  • C to A, chromosome 10 at 80,295,972 bp
  • A to G, chromosome 11 at 74,667,104 bp
  • A to G, chromosome 11 at 109,661,075 bp
  • A to T, chromosome 11 at 118,094,808 bp
  • T to A, chromosome 11 at 118,279,824 bp
  • C to T, chromosome 11 at 118,303,716 bp
  • T to C, chromosome 12 at 81,167,513 bp
  • G to A, chromosome 12 at 98,825,523 bp
  • A to T, chromosome 13 at 54,552,968 bp
  • G to T, chromosome 14 at 34,399,560 bp
  • T to G, chromosome 15 at 6,789,473 bp
  • T to C, chromosome 15 at 38,019,242 bp
  • T to G, chromosome 16 at 23,977,554 bp
  • A to T, chromosome 16 at 90,783,376 bp
  • A to G, chromosome 18 at 78,350,150 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3900 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041607-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.