Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3900Btlr/Mmmh
Stock Number:
041607-MU
Citation ID:
RRID:MMRRC_041607-MU
Other Names:
R3900 (G1), C57BL/6J-MtgxR3900Btlr
Major Collection:

Strain Information

Prkar1a
Name: protein kinase, cAMP dependent regulatory, type I, alpha
Synonyms: Tse-1, Tse1, 1300018C22Rik, RIalpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19084
HGNC: HGNC:9388
Homologene: 37664
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Srrm1
Name: serine/arginine repetitive matrix 1
Synonyms: SRm160
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 51796
Eif2ak4
Name: eukaryotic translation initiation factor 2 alpha kinase 4
Synonyms: GCN2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27103
Homologene: 40891
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 172,489,558 bp
  • T to C, chromosome 1 at 184,074,250 bp
  • T to C, chromosome 1 at 191,985,256 bp
  • C to A, chromosome 2 at 13,286,980 bp
  • T to C, chromosome 2 at 35,085,216 bp
  • A to T, chromosome 2 at 88,794,929 bp
  • A to G, chromosome 2 at 118,475,029 bp
  • A to G, chromosome 2 at 120,713,549 bp
  • A to G, chromosome 2 at 122,178,841 bp
  • G to A, chromosome 3 at 59,227,668 bp
  • A to T, chromosome 4 at 135,321,466 bp
  • T to C, chromosome 4 at 138,896,885 bp
  • T to C, chromosome 4 at 139,479,062 bp
  • G to A, chromosome 5 at 139,971,964 bp
  • A to G, chromosome 6 at 113,318,433 bp
  • A to T, chromosome 6 at 118,121,014 bp
  • T to C, chromosome 6 at 118,429,566 bp
  • G to T, chromosome 7 at 47,335,527 bp
  • A to G, chromosome 7 at 79,839,225 bp
  • A to G, chromosome 7 at 101,191,799 bp
  • C to A, chromosome 7 at 143,479,770 bp
  • A to G, chromosome 8 at 72,469,936 bp
  • A to G, chromosome 9 at 39,839,402 bp
  • C to T, chromosome 9 at 41,031,564 bp
  • A to T, chromosome 9 at 64,928,144 bp
  • G to A, chromosome 9 at 108,575,769 bp
  • T to C, chromosome 9 at 110,118,518 bp
  • C to T, chromosome 9 at 110,592,518 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • T to A, chromosome 10 at 42,789,286 bp
  • C to A, chromosome 10 at 80,295,972 bp
  • A to G, chromosome 11 at 74,667,104 bp
  • A to G, chromosome 11 at 109,661,075 bp
  • A to T, chromosome 11 at 118,094,808 bp
  • T to A, chromosome 11 at 118,279,824 bp
  • C to T, chromosome 11 at 118,303,716 bp
  • T to C, chromosome 12 at 81,167,513 bp
  • G to A, chromosome 12 at 98,825,523 bp
  • A to T, chromosome 13 at 54,552,968 bp
  • G to T, chromosome 14 at 34,399,560 bp
  • T to G, chromosome 15 at 6,789,473 bp
  • T to C, chromosome 15 at 38,019,242 bp
  • T to G, chromosome 16 at 23,977,554 bp
  • A to T, chromosome 16 at 90,783,376 bp
  • A to G, chromosome 18 at 78,350,150 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3900 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041607-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.