Strain Name:
C57BL/6J-MtgxR4024Btlr/Mmmh
Stock Number:
041612-MU
Citation ID:
RRID:MMRRC_041612-MU
Other Names:
R4024 (G1), C57BL/6J-MtgxR4024Btlr
Major Collection:

Strain Information

Vangl2
Name: VANGL planar cell polarity 2
Synonyms: ska17, Lpp1, Lootl, Ltap, strabismus, loop-tail, C530001F03Rik, skam17Jus
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93840
Homologene: 62161
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Gpr6
Name: G protein-coupled receptor 6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140741
VEGA: 10
HGNC: HGNC:4515
Homologene: 38026
Ubp1
Name: upstream binding protein 1
Synonyms: LBP-1a, LBP-1b, NF2d9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22221
VEGA: 9
Homologene: 8435
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 2500002E12Rik, 1100001C18Rik, A330076K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Slk
Name: STE20-like kinase
Synonyms: SLK, mSLK, 9A2, Etk4, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Nisch
Name: nischarin
Synonyms: edsn, 3202002H23Rik, 1200007D05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: motor end-plate disease, ataxia 3, nur14, seal, nmf58, mnd-2, mnd2, C630029C19Rik, nmf2, nmf335, NMF335, med, Nav1.6, NaCh6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: 2610509D04Rik, Ggtb3, Bchs, D5Ertd66e, Bwf1, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Ppp3r1
Name: protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I)
Synonyms: CaNB1, PP2B beta 1, Cnb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19058
HGNC: HGNC:9317
Homologene: 68099
Foxk2
Name: forkhead box K2
Synonyms: 1110054H05Rik, 5730434B08Rik, Ilf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68837
HGNC: HGNC:6036
Homologene: 18748
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: Fam208b, BC016423
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Cndp1
Name: carnosine dipeptidase 1
Synonyms: Cn1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 338403
Homologene: 57178
Cmip
Name: c-Maf inducing protein
Synonyms: 4933407C03Rik, 5830471E12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74440
Homologene: 18869
Zfp988
Name: zinc finger protein 988
Synonyms: Gm13151
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 115489950
Bpifb1
Name: BPI fold containing family B, member 1
Synonyms: LPlunc1, U46068, von Ebner minor salivary protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228801
Homologene: 50047
Zfp808
Name: zinc finger protein 808
Synonyms: Gm7036
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 630579
Homologene: 134631
Nkx2-2
Name: NK2 homeobox 2
Synonyms: Nkx2.2, tinman, Nkx-2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18088
HGNC: HGNC:7835
Homologene: 1879
Colec10
Name: collectin sub-family member 10
Synonyms: CL-L1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239447
VEGA: 15
HGNC: HGNC:2220
Homologene: 31381
Vmn2r6
Name: vomeronasal 2, receptor 6
Synonyms: EG620718, EG667069
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667069
Homologene: 129754
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: GlcT-1, Epcs21, Ugcgl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22234
Homologene: 37763
Hnmt
Name: histamine N-methyltransferase
Synonyms: 1500031F01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140483
HGNC: HGNC:5028
Homologene: 5032
Or10aa3
Name: olfactory receptor family 10 subfamily AA member 3
Synonyms: MOR123-2, Olfr432, GA_x6K02T2P20D-21124681-21123743
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258711
Homologene: 81532
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Fbxl4
Name: F-box and leucine-rich repeat protein 4
Synonyms: FBL4, FBL5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269514
Homologene: 8128
Hs2st1
Name: heparan sulfate 2-O-sulfotransferase 1
Synonyms: Hs2st
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23908
HGNC: HGNC:5193
Homologene: 8025
Mroh8
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 629499
Homologene: 51864
Adamts9
Name: ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms: Mhdaund3, 8430403M15Rik, UND4, E030027K14Rik, UND3, Mhdaund4, 1810011L16Rik, Gsfund3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101401
Homologene: 18821
Cap2
Name: cyclase associated actin cytoskeleton regulatory protein 2
Synonyms: 2810452G09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67252
Homologene: 101397
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Aoc1
Name: amine oxidase, copper-containing 1
Synonyms: Abp1, 1600012D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76507
HGNC: HGNC:80
Homologene: 68159
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Vsig10l
Name: V-set and immunoglobulin domain containing 10 like
Synonyms: 2210412E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75690
Homologene: 35386
Vmn1r216
Name: vomeronasal 1 receptor 216
Synonyms: V1ri10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171279
Homologene: 110880
Plekhn1
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 231002
VEGA: 4
Homologene: 12949
Or5p63
Name: olfactory receptor family 5 subfamily P member 63
Synonyms: MOR204-31P, Olfr487, MOR204-31P, MOR204-29P, GA_x6K02T2PBJ9-10541702-10540758, Olfr1538-ps1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258042
Homologene: 110483
Grk3
Name: G protein-coupled receptor kinase 3
Synonyms: 4833444A01Rik, Adrbk2, Adrbk-2, Bark-2, beta ARK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320129
HGNC: HGNC:290
Homologene: 21072
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clc4-2, Clcn4-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Vmn2r120
Name: vomeronasal 2, receptor 120
Synonyms: EG224916
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224916
Thsd4
Name: thrombospondin, type I, domain containing 4
Synonyms: ADAMTSL6, B230114P05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 207596
Homologene: 49796
Ttbk2
Name: tau tubulin kinase 2
Synonyms: 2610507N02Rik, B930008N24Rik, TTK
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Lrriq4
Name: leucine-rich repeats and IQ motif containing 4
Synonyms: 4930558O21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68307
Homologene: 12260
Tyk2
Name: tyrosine kinase 2
Synonyms: JTK1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54721
VEGA: 9
Homologene: 20712
Ctnna2
Name: catenin alpha 2
Synonyms: alpha(N)-catenin, chp, catenin (cadherin associated protein), alpha 2, Catna, Catna2, alpha N-catenin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 2810039F03Rik, Ankrd64, 6330439K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241688
Homologene: 10037
Bivm
Name: basic, immunoglobulin-like variable motif containing
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 246229
Homologene: 9783
Eef2k
Name: eukaryotic elongation factor-2 kinase
Synonyms: eEF-2K
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13631
Homologene: 7299
Or2t47
Name: olfactory receptor family 2 subfamily T member 47
Synonyms: GA_x6K02T2NKPP-873285-874217, Olfr328, MOR275-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258495
Homologene: 133015
Vmn1r34
Name: vomeronasal 1 receptor 34
Synonyms: Gm5991
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546901
Homologene: 110800
Lrriq3
Name: leucine-rich repeats and IQ motif containing 3
Synonyms: 4933403H06Rik, Lrrc44, 4930511J15Rik, 4930438B07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74435
Homologene: 23668
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: Gpr128, 9130020O16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Bhmt2
Name: betaine-homocysteine methyltransferase 2
Synonyms: C81077, D13Ucla2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 64918
HGNC: HGNC:1048
Homologene: 49496
Or8w1
Name: olfactory receptor family 8 subfamily U member 1
Synonyms: Olfr1132, GA_x6K02T2Q125-49140947-49140021, MOR177-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258833
Homologene: 121518
Igf2
Name: insulin-like growth factor 2
Synonyms: Igf-II, Peg2, Mpr, M6pr, Igf-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16002
HGNC: HGNC:5466
Homologene: 510
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 44,137,128 bp
  • T to C, chromosome 1 at 172,008,041 bp
  • C to T, chromosome 1 at 174,051,117 bp
  • T to C, chromosome 2 at 24,003,765 bp
  • T to A, chromosome 2 at 87,635,155 bp
  • T to C, chromosome 2 at 120,760,255 bp
  • T to C, chromosome 2 at 144,482,227 bp
  • T to C, chromosome 2 at 147,184,234 bp
  • A to T, chromosome 2 at 154,213,046 bp
  • A to G, chromosome 2 at 157,256,352 bp
  • T to C, chromosome 3 at 30,650,273 bp
  • A to T, chromosome 3 at 64,538,250 bp
  • T to C, chromosome 3 at 144,434,725 bp
  • G to A, chromosome 3 at 155,188,302 bp
  • T to C, chromosome 4 at 22,377,074 bp
  • C to T, chromosome 4 at 59,207,798 bp
  • A to C, chromosome 4 at 147,332,785 bp
  • T to A, chromosome 4 at 148,014,283 bp
  • A to G, chromosome 4 at 156,224,750 bp
  • A to G, chromosome 5 at 101,924,095 bp
  • T to A, chromosome 5 at 112,914,984 bp
  • A to T, chromosome 6 at 48,908,269 bp
  • T to A, chromosome 6 at 66,637,704 bp
  • A to T, chromosome 6 at 77,636,844 bp
  • A to G, chromosome 6 at 92,872,784 bp
  • T to G, chromosome 7 at 7,290,428 bp
  • T to C, chromosome 7 at 43,468,086 bp
  • A to T, chromosome 7 at 108,211,742 bp
  • A to G, chromosome 7 at 120,858,598 bp
  • A to G, chromosome 7 at 142,654,307 bp
  • A to G, chromosome 8 at 117,447,416 bp
  • G to A, chromosome 9 at 21,115,919 bp
  • T to C, chromosome 9 at 60,252,636 bp
  • A to G, chromosome 9 at 70,324,875 bp
  • A to G, chromosome 9 at 113,944,883 bp
  • T to C, chromosome 9 at 119,137,340 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 9 at 121,044,849 bp
  • T to C, chromosome 10 at 8,729,917 bp
  • G to A, chromosome 10 at 41,071,268 bp
  • A to G, chromosome 10 at 41,993,058 bp
  • T to C, chromosome 11 at 17,194,786 bp
  • G to A, chromosome 11 at 58,551,396 bp
  • T to A, chromosome 11 at 121,285,613 bp
  • A to G, chromosome 12 at 80,168,477 bp
  • T to C, chromosome 13 at 3,584,554 bp
  • A to G, chromosome 13 at 23,099,891 bp
  • C to T, chromosome 13 at 46,637,841 bp
  • T to A, chromosome 13 at 62,171,730 bp
  • G to A, chromosome 13 at 93,663,331 bp
  • T to A, chromosome 14 at 12,705,539 bp
  • A to G, chromosome 14 at 31,176,819 bp
  • C to T, chromosome 14 at 50,362,846 bp
  • A to G, chromosome 15 at 54,462,551 bp
  • A to G, chromosome 15 at 101,039,793 bp
  • A to T, chromosome 16 at 56,730,298 bp
  • T to A, chromosome 17 at 57,536,718 bp
  • T to C, chromosome 18 at 84,628,813 bp
  • A to G, chromosome 19 at 47,622,370 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4024 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041612-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.