Strain Name:
C57BL/6J-MtgxR4364Btlr/Mmmh
Stock Number:
041672-MU
Citation ID:
RRID:MMRRC_041672-MU
Other Names:
R4364 (G1), C57BL/6J-MtgxR4364Btlr
Major Collection:

Gene Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Apoa5
Name: apolipoprotein A-V
Synonyms: 1300007O05Rik, Apoav, RAP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66113
Homologene: 14197
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Exoc6b
Name: exocyst complex component 6B
Synonyms: Sec15l2, 4930569O18Rik, G430127E12Rik, Sec15b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75914
Homologene: 44781
Eif4e2
Name: eukaryotic translation initiation factor 4E member 2
Synonyms: D0H0S6743E, 2700069E09Rik, Eif4el3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26987
HGNC: HGNC:3293
Homologene: 128466
Dhx35
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 35
Synonyms: Ddx35, 1200009D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71715
Homologene: 6406
Shroom3
Name: shroom family member 3
Synonyms: Shrm3, Shrm, D5Ertd287e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Cct2
Name: chaperonin containing Tcp1, subunit 2 (beta)
Synonyms: Cctb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12461
VEGA: 10
HGNC: HGNC:1615
Homologene: 4696
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70699
Homologene: 45971
Usp10
Name: ubiquitin specific peptidase 10
Synonyms: Uchrp, 2610014N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 22224
Homologene: 31294
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: QBRICK, crf11, eyem02Jus, eyes2, heb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329872
Homologene: 27049
Il7r
Name: interleukin 7 receptor
Synonyms: CD127, IL-7Ralpha, IL-7 receptor alpha chain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16197
VEGA: 15
HGNC: HGNC:6024
Homologene: 1646
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: 1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 193385
Homologene: 9284
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71685
Homologene: 56997
Fat1
Name: FAT atypical cadherin 1
Synonyms: Fath, mFat1, 2310038E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: 6430584G11Rik, DPRP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Mideas
Name: mitotic deacetylase associated SANT domain protein
Synonyms: 9430029N19Rik, C130039O16Rik, Elmsan1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238317
Homologene: 19330
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: Spnb5, EG640524
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 640524
Homologene: 41150
Lcn10
Name: lipocalin 10
Synonyms: 9230112J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 332578
Homologene: 52253
Rhbdl2
Name: rhomboid like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230726
Homologene: 49508
Prkce
Name: protein kinase C, epsilon
Synonyms: 5830406C15Rik, Pkce, PKCepsilon, PKC[e]
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18754
HGNC: HGNC:9401
Homologene: 48343
Shoc1
Name: shortage in chiasmata 1
Synonyms: LOC242489, Mzip2, Gm426, AI481877
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100155
Homologene: 79783
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Tex10
Name: testis expressed gene 10
Synonyms: 2610206N19Rik, clone 18330, 2810462N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 269536
Homologene: 32361
Glipr1
Name: GLI pathogenesis-related 1 (glioma)
Synonyms: RTVP-1, mRTVP-1, 2410114O14Rik, RTVP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73690
Homologene: 21357
Hspa4l
Name: heat shock protein 4 like
Synonyms: 94kDa, Osp94, APG-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18415
Homologene: 22610
Amn
Name: amnionless
Synonyms: 5033428N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 93835
VEGA: 12
Homologene: 12804
Krt83
Name: keratin 83
Synonyms: 5430421N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 100126226
HGNC: HGNC:6460
Homologene: 68248
Ehf
Name: ets homologous factor
Synonyms: 9030625L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13661
HGNC: HGNC:3246
Homologene: 7301
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Ttll1
Name: tubulin tyrosine ligase-like 1
Synonyms: 6330444E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319953
HGNC: HGNC:1312
Homologene: 8174
Taar8c
Name: trace amine-associated receptor 8C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 494546
Homologene: 77586
Ccer1
Name: coiled-coil glutamate-rich protein 1
Synonyms: 4921510H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 66716
VEGA: 10
Homologene: 49839
Olfr1425
Name: olfactory receptor 1425
Synonyms: MOR239-7, GA_x6K02T2RE5P-2433425-2432490
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258155
Homologene: 17398
Olfr876
Name: olfactory receptor 876
Synonyms: GA_x6K02T2PVTD-31489645-31490577, MOR161-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258883
Homologene: 74154
Olfr1293-ps
Name: olfactory receptor 1293, pseudogene
Synonyms: OTTMUSG00000015076, MOR245-24P, GA_x6K02T2Q125-72578807-72579745
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 623583
Gm23573
Name: predicted gene, 23573
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
VEGA: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 40,351,791 bp
  • T to C, chromosome 1 at 87,224,371 bp
  • G to T, chromosome 2 at 25,684,040 bp
  • G to T, chromosome 2 at 103,273,901 bp
  • G to A, chromosome 2 at 111,527,640 bp
  • A to G, chromosome 2 at 120,068,655 bp
  • A to G, chromosome 2 at 130,970,208 bp
  • C to T, chromosome 2 at 158,842,352 bp
  • C to A, chromosome 3 at 40,766,809 bp
  • T to C, chromosome 4 at 48,468,774 bp
  • T to G, chromosome 4 at 59,082,294 bp
  • A to T, chromosome 4 at 82,913,251 bp
  • T to A, chromosome 4 at 123,809,935 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • C to A, chromosome 6 at 35,192,027 bp
  • A to T, chromosome 6 at 85,003,179 bp
  • T to A, chromosome 8 at 44,952,962 bp
  • A to G, chromosome 8 at 119,951,946 bp
  • A to T, chromosome 9 at 37,804,190 bp
  • A to T, chromosome 9 at 46,270,529 bp
  • A to G, chromosome 10 at 5,353,987 bp
  • C to T, chromosome 10 at 24,101,579 bp
  • CGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 10 at 97,694,370 bp
  • T to C, chromosome 10 at 111,985,637 bp
  • A to G, chromosome 10 at 117,055,151 bp
  • C to T, chromosome 12 at 84,156,471 bp
  • A to C, chromosome 12 at 111,271,762 bp
  • C to T, chromosome 13 at 24,721,711 bp
  • A to G, chromosome 14 at 34,946,032 bp
  • T to A, chromosome 15 at 9,512,928 bp
  • T to A, chromosome 15 at 83,499,994 bp
  • T to G, chromosome 15 at 101,487,514 bp
  • A to G, chromosome 16 at 93,770,924 bp
  • T to C, chromosome 17 at 56,187,391 bp
  • A to G, chromosome 17 at 73,512,159 bp
  • C to T, chromosome 17 at 86,476,851 bp
  • A to G, chromosome 19 at 12,074,497 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4364 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041672-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.