Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4367Btlr/Mmmh
Stock Number:
041673-MU
Citation ID:
RRID:MMRRC_041673-MU
Other Names:
R4367 (G1), C57BL/6J-MtgxR4367Btlr
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Sdf2
Name: stromal cell derived factor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20316
Homologene: 5045
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Git2
Name: GIT ArfGAP 2
Synonyms: Cool associated tyrosine phosphorylated-2, Cat-2, ARF GTPase activating protein 2, 5830420E16Rik, B230104M05Rik, 1500036H07Rik, 9630056M03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 161,847,230 bp
  • G to C, chromosome 1 at 162,833,648 bp
  • C to A, chromosome 1 at 171,274,043 bp
  • T to C, chromosome 2 at 25,907,626 bp
  • T to C, chromosome 2 at 164,461,395 bp
  • T to C, chromosome 3 at 33,826,522 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • T to C, chromosome 3 at 108,911,171 bp
  • T to C, chromosome 3 at 122,276,497 bp
  • T to C, chromosome 3 at 126,946,149 bp
  • ACAGGTTTCTTCAGGTTTCTT to ACAGGTTTCTT, chromosome 4 at 72,118,163 bp
  • G to A, chromosome 5 at 107,601,795 bp
  • T to A, chromosome 5 at 114,764,666 bp
  • C to T, chromosome 5 at 142,494,805 bp
  • A to C, chromosome 6 at 18,405,249 bp
  • T to C, chromosome 6 at 48,976,130 bp
  • A to G, chromosome 6 at 73,149,484 bp
  • T to A, chromosome 6 at 116,460,963 bp
  • T to C, chromosome 6 at 122,887,378 bp
  • T to C, chromosome 6 at 123,828,537 bp
  • G to A, chromosome 6 at 124,861,695 bp
  • C to T, chromosome 7 at 65,682,819 bp
  • C to T, chromosome 7 at 104,149,718 bp
  • GAACAACAACAA to GAACAACAA, chromosome 7 at 106,891,360 bp
  • C to T, chromosome 7 at 108,621,889 bp
  • C to T, chromosome 7 at 127,906,419 bp
  • G to A, chromosome 8 at 84,127,268 bp
  • T to C, chromosome 8 at 94,476,564 bp
  • C to T, chromosome 8 at 109,553,131 bp
  • A to G, chromosome 9 at 5,299,333 bp
  • G to A, chromosome 9 at 39,144,429 bp
  • T to C, chromosome 9 at 57,700,149 bp
  • C to T, chromosome 9 at 108,024,446 bp
  • T to C, chromosome 9 at 119,388,715 bp
  • A to G, chromosome 10 at 13,253,820 bp
  • A to T, chromosome 10 at 71,233,403 bp
  • A to G, chromosome 11 at 36,027,398 bp
  • C to T, chromosome 11 at 59,803,784 bp
  • T to C, chromosome 11 at 62,118,530 bp
  • C to T, chromosome 11 at 78,251,037 bp
  • G to T, chromosome 11 at 80,140,330 bp
  • A to T, chromosome 11 at 102,023,420 bp
  • A to T, chromosome 13 at 50,469,884 bp
  • T to C, chromosome 14 at 20,561,134 bp
  • T to C, chromosome 16 at 14,218,883 bp
  • T to A, chromosome 18 at 12,513,690 bp
  • T to C, chromosome 18 at 62,179,056 bp
  • C to T, chromosome 19 at 3,899,069 bp
  • T to C, chromosome 19 at 18,827,525 bp
  • A to T, chromosome X at 134,435,135 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4367 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041673-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.