Strain Name:
C57BL/6J-MtgxR4367Btlr/Mmmh
Stock Number:
041673-MU
Citation ID:
RRID:MMRRC_041673-MU
Other Names:
R4367 (G1), C57BL/6J-MtgxR4367Btlr
Major Collection:

Gene Information

Ank2
Name: ankyrin 2, brain
Synonyms: Ankyrin-2, Gm4392, Ank-2, ankyrin B, Ankyrin-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 109676
HGNC: HGNC:493
Homologene: null
Sdf2
Name: stromal cell derived factor 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20316
Homologene: 5045
Dhx38
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 64340
Homologene: 8512
Suco
Name: SUN domain containing ossification factor
Synonyms: AI848100, osteopotentia, Opt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Estm14, Tle4l, Grg1, C230057C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 21885
Homologene: 21058
Git2
Name: GIT ArfGAP 2
Synonyms: Cat-2, 5830420E16Rik, 9630056M03Rik, B230104M05Rik, Cool associated tyrosine phosphorylated-2, ARF GTPase activating protein 2, 1500036H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: D3Bwg1534e, 2610040L17Rik, Ten-m2, Odz2, 9330187F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 23964
Homologene: 22672
Tefm
Name: transcription elongation factor, mitochondrial
Synonyms: FLJ22729, 1110002N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68550
Homologene: 11657
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99480
Homologene: 124162
Cyp1a1
Name: cytochrome P450, family 1, subfamily a, polypeptide 1
Synonyms: P450-1, cytochrome P450 subfamily I, polypeptide 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 13076
VEGA: 9
HGNC: HGNC:2595
Homologene: 68062
Mpp3
Name: membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms: Dlgh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 13384
HGNC: HGNC:7221
Homologene: 31065
Necap1
Name: NECAP endocytosis associated 1
Synonyms: 1200016B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67602
Homologene: 22902
Usp54
Name: ubiquitin specific peptidase 54
Synonyms: 4930429G18Rik, C030002J06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 78787
Homologene: 90902
Flcn
Name: folliculin
Synonyms: B430214A04Rik, BHD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216805
Homologene: 14583
Tarsl2
Name: threonyl-tRNA synthetase-like 2
Synonyms: A530046H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 272396
Homologene: 65036
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Casp1
Name: caspase 1
Synonyms: Caspase-1, interleukin 1 beta-converting enzyme, ICE, Il1bc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 12362
VEGA: 9
HGNC: HGNC:1499
Homologene: 133272
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225997
VEGA: 19
Homologene: 9767
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
B4galt3
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms: ESTM26, R74981, beta4GalT-III, 9530061M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 57370
HGNC: HGNC:926
Homologene: 48241
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 434341
Homologene: 88935
Specc1
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: B230396K10Rik, 2810012G08Rik, Cytsb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 432572
Homologene: 45157
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 51938
Homologene: 12149
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 545874
HGNC: null
Homologene: 135915
Ubqlnl
Name: ubiquilin-like
Synonyms: 4922504M18Rik, LOC244179
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 244179
Homologene: 17034
Kcnt1
Name: potassium channel, subfamily T, member 1
Synonyms: slo2, C030030G16Rik, Slack
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227632
Homologene: 11055
Rpap2
Name: RNA polymerase II associated protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231571
Homologene: 11733
Adrb2
Name: adrenergic receptor, beta 2
Synonyms: beta 2-adrenoceptor, beta 2-AR, Gpcr7, Adrb-2, Badm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 11555
VEGA: 18
HGNC: HGNC:286
Homologene: 30948
Olfr27
Name: olfactory receptor 27
Synonyms: MTPCR56, GA_x6K02T2PVTD-32841223-32842158, MOR171-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258826
VEGA: 9
HGNC: null
Homologene: 110610
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, 3010022N24Rik, Cortbp2, 9130022E09Rik, 4732477G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 30785
Homologene: 14125
Alox5
Name: arachidonate 5-lipoxygenase
Synonyms: 5-LOX, 5LO, 5LX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11689
HGNC: HGNC:435
Homologene: 561
Fmo1
Name: flavin containing monooxygenase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14261
HGNC: HGNC:3769
Homologene: 55520
Olfr507
Name: olfactory receptor 507
Synonyms: GA_x6K02T2PBJ9-10951546-10952496, MOR204-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258738
HGNC: null
Homologene: 27249
Doxl2
Name: diamine oxidase-like protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 243376
HGNC: null
Homologene: 19443
Xylb
Name: xylulokinase homolog (H. influenzae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 102448
VEGA: 9
Homologene: 3746
Radil
Name: Ras association and DIL domains
Synonyms: D930005D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231858
Homologene: 77648
Phactr2
Name: phosphatase and actin regulator 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 215789
Homologene: 8816
Prpf38b
Name: PRP38 pre-mRNA processing factor 38 (yeast) domain containing B
Synonyms: 1110021E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 66921
Homologene: 9986
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, Kv4.3, potassium channel Kv4.3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Tcirg1
Name: T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Synonyms: OC-116, Atp6i, V-ATPase a3, TIRC7, ATP6a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 27060
Homologene: 4392
Gpr162
Name: G protein-coupled receptor 162
Synonyms: Grca, A-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14788
Homologene: 8400
Podnl1
Name: podocan-like 1
Synonyms: 5832418A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244550
Homologene: 41590
Drp2
Name: dystrophin related protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 13497
HGNC: HGNC:3032
Homologene: 55620
Tfam
Name: transcription factor A, mitochondrial
Synonyms: Hmgts, mtTFA, tsHMG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 21780
Homologene: 31139
Olfr707
Name: olfactory receptor 707
Synonyms: MOR260-8P, GA_x6K02T2PBJ9-9276470-9275547
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 194433
Homologene: 133899
Bckdk
Name: branched chain ketoacid dehydrogenase kinase
Synonyms: BCKD-kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 12041
Homologene: 37642
Sys1
Name: SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Synonyms: 2610042O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 66460
Homologene: 43135
Gm20662
Name: predicted gene 20662
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: null
HGNC: null
Homologene: null
Gm806
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 161,847,230 bp
  • G to C, chromosome 1 at 162,833,648 bp
  • C to A, chromosome 1 at 171,274,043 bp
  • T to C, chromosome 2 at 25,907,626 bp
  • T to C, chromosome 2 at 164,461,395 bp
  • T to C, chromosome 3 at 33,826,522 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • T to C, chromosome 3 at 108,911,171 bp
  • T to C, chromosome 3 at 122,276,497 bp
  • T to C, chromosome 3 at 126,946,149 bp
  • ACAGGTTTCTTCAGGTTTCTT to ACAGGTTTCTT, chromosome 4 at 72,118,163 bp
  • G to A, chromosome 5 at 107,601,795 bp
  • T to A, chromosome 5 at 114,764,666 bp
  • C to T, chromosome 5 at 142,494,805 bp
  • A to C, chromosome 6 at 18,405,249 bp
  • T to C, chromosome 6 at 48,976,130 bp
  • A to G, chromosome 6 at 73,149,484 bp
  • T to A, chromosome 6 at 116,460,963 bp
  • T to C, chromosome 6 at 122,887,378 bp
  • T to C, chromosome 6 at 123,828,537 bp
  • G to A, chromosome 6 at 124,861,695 bp
  • C to T, chromosome 7 at 65,682,819 bp
  • C to T, chromosome 7 at 104,149,718 bp
  • GAACAACAACAA to GAACAACAA, chromosome 7 at 106,891,360 bp
  • C to T, chromosome 7 at 108,621,889 bp
  • C to T, chromosome 7 at 127,906,419 bp
  • G to A, chromosome 8 at 84,127,268 bp
  • T to C, chromosome 8 at 94,476,564 bp
  • C to T, chromosome 8 at 109,553,131 bp
  • A to G, chromosome 9 at 5,299,333 bp
  • G to A, chromosome 9 at 39,144,429 bp
  • T to C, chromosome 9 at 57,700,149 bp
  • C to T, chromosome 9 at 108,024,446 bp
  • T to C, chromosome 9 at 119,388,715 bp
  • A to G, chromosome 10 at 13,253,820 bp
  • A to T, chromosome 10 at 71,233,403 bp
  • A to G, chromosome 11 at 36,027,398 bp
  • C to T, chromosome 11 at 59,803,784 bp
  • T to C, chromosome 11 at 62,118,530 bp
  • C to T, chromosome 11 at 78,251,037 bp
  • G to T, chromosome 11 at 80,140,330 bp
  • A to T, chromosome 11 at 102,023,420 bp
  • A to T, chromosome 13 at 50,469,884 bp
  • T to C, chromosome 14 at 20,561,134 bp
  • T to C, chromosome 16 at 14,218,883 bp
  • T to A, chromosome 18 at 12,513,690 bp
  • T to C, chromosome 18 at 62,179,056 bp
  • C to T, chromosome 19 at 3,899,069 bp
  • T to C, chromosome 19 at 18,827,525 bp
  • A to T, chromosome X at 134,435,135 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4367 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041673-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.