Strain Name:
Stock Number:
Citation ID:
Other Names:
R4379 (G1), C57BL/6J-MtgxR4379Btlr
Major Collection:

Strain Information

Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13798
Homologene: 50663
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13518
Homologene: 136716
Name: zinc finger, MYND-type containing 8
Synonyms: 2010005I16Rik, 1110013E22Rik, ZMYND8, RACK7, 3632413B07Rik, Prkcbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228880
Homologene: 32679
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 211651
Homologene: 13212
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20133
Homologene: 806
Name: transcription factor 7 like 2, T cell specific, HMG box
Synonyms: TCF4E, TCF4B, mTcf-4E, mTcf-4B, Tcf-4, Tcf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21416
Homologene: 7564
Name: TATA-box binding protein associated factor, RNA polymerase I, D
Synonyms: 4930553M18Rik, Josd3, TAFI41, TAF(I)41
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75316
Homologene: 11472
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21885
Homologene: 21058
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17847
Homologene: 40978
Name: A kinase (PRKA) anchor protein 8-like
Synonyms: Nakap95
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 54194
VEGA: 17
Homologene: 8658
Name: Ngg1 interacting factor 3-like 1 (S. pombe)
Synonyms: 1110030G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 65102
Homologene: 5881
Name: intraflagellar transport 74
Synonyms: 1700029H06Rik, Cmg1, Ccdc2, b2b796Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67694
Homologene: 11831
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108073
Homologene: 20233
Name: limb region 1 like
Synonyms: 1110013E13Rik, D15Ertd735e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74775
Homologene: 10011
Name: neurogenic differentiation 6
Synonyms: Math-2, Nex, Atoh2, Nex1m, Math2, bHLHa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11922
Homologene: 7632
Name: triggering receptor expressed on myeloid cells-like 1
Synonyms: TLT-1, 5430401J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71326
VEGA: 17
Homologene: 52257
Name: congenital dyserythropoietic anemia, type I (human)
Synonyms: CDA-I, CDA1, 1500015A01Rik, codanin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68968
Homologene: 16324
Name: low-density lipoprotein receptor-related protein 10
Synonyms: Lrp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 65107
VEGA: 14
Homologene: 8535
Name: polybromo 1
Synonyms: BAF180, 2610016F04Rik, 2310032M22Rik, Pb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66923
Homologene: 10044
Name: A kinase (PRKA) anchor protein 8
Synonyms: AKAP95, 1200016A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56399
VEGA: 17
Homologene: 4278
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99003
Homologene: 11710
Name: expressed sequence AW209491
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105351
VEGA: 13
Homologene: 11439
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225115
Homologene: 25090
Name: vaccinia related kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101568
Homologene: 9509
Name: glycosyltransferase 1 domain containing 1
Synonyms: 5730455A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319804
Homologene: 16965
Name: 3-hydroxyisobutyrate dehydrogenase
Synonyms: 6430402H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 58875
Homologene: 15088
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14972
Homologene: 128352
Name: pseudouridylate synthase 7
Synonyms: C330017I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 78697
Homologene: 6998
Name: adenylate cyclase 3
Synonyms: AC3, ACIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104111
Homologene: 2978
Name: vomeronasal 2, receptor 115
Synonyms: EG638102, V2Rp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 638102
Homologene: 86604
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 378425
Homologene: 16972
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18186
Homologene: 2876
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18669
Homologene: 69084
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110521
VEGA: 13
Homologene: 1596
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241263
Homologene: 19381
Name: tripartite motif-containing 28
Synonyms: KRIP-1, KAP-1, Tif1b, MommeD9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21849
Homologene: 21175
Name: immunoglobulin superfamily, member 9B
Synonyms: LOC235086, AI414108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235086
Homologene: 19472
Name: ceramide synthase 5
Synonyms: 2310081H14Rik, Trh4, CerS5, Lass5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 71949
Homologene: 23634
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
Homologene: 69348
Name: leucine rich repeat containing 34
Synonyms: 1700007J06Rik, Spata34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71827
Homologene: 27419
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
Synonyms: AU023434
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233332
Homologene: 16373
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71481
Homologene: 11849
Name: zinc finger protein 28
Synonyms: mkr-5, Zfp-28, 2810438M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22690
Homologene: 69047
Name: olfactory receptor family 7 subfamily G member 34
Synonyms: GA_x6K02T2PVTD-13313295-13312357, MOR147-3, Olfr854
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258515
Homologene: 128144
Name: zinc finger and SCAN domain containing 4D
Synonyms: EG545913
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 545913
Homologene: 85986
Name: endosomal transmembrane epsin interactor 3
Synonyms: 1110013L07Rik, Fam189b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68521
Homologene: 4805
Name: olfactory receptor family 5 subfamily AC member 15
Synonyms: GA_x54KRFPKG5P-55348161-55347241, MOR182-7P, MOR182-13, Olfr194
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 433031
Homologene: 122781
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240427
Homologene: 9192
Name: mitochondrial elongation factor 1
Synonyms: Smcr7l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239555
VEGA: 15
Homologene: 10374
Name: agmatine ureohydrolase (agmatinase)
Synonyms: 5033405N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75986
Homologene: 99855
Name: predicted pseudogene 10051
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100039731
Homologene: 131872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Name: immunoglobulin kappa variable 4-81
Synonyms: LOC243453
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243453
Name: ribosomal protein L21, pseudogene 3
Synonyms: EG432665, Gm10084
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432665
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,163,235 bp
  • A to G, chromosome 1 at 34,227,975 bp
  • A to C, chromosome 1 at 58,455,579 bp
  • A to G, chromosome 1 at 120,603,355 bp
  • G to T, chromosome 2 at 21,825,214 bp
  • G to T, chromosome 2 at 104,766,059 bp
  • A to G, chromosome 2 at 120,726,618 bp
  • A to T, chromosome 2 at 165,807,938 bp
  • A to G, chromosome 3 at 30,631,375 bp
  • A to T, chromosome 3 at 89,185,757 bp
  • C to T, chromosome 3 at 127,729,373 bp
  • ACAGGTTTCTTCAGGTTTCTT to ACAGGTTTCTT, chromosome 4 at 72,118,163 bp
  • A to G, chromosome 4 at 94,679,934 bp
  • G to T, chromosome 4 at 141,757,491 bp
  • C to A, chromosome 5 at 8,865,875 bp
  • T to C, chromosome 5 at 23,748,866 bp
  • T to C, chromosome 5 at 127,694,282 bp
  • C to T, chromosome 5 at 133,475,448 bp
  • T to C, chromosome 6 at 40,833,859 bp
  • G to A, chromosome 6 at 52,620,042 bp
  • T to C, chromosome 6 at 55,679,272 bp
  • A to G, chromosome 6 at 68,990,949 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • T to A, chromosome 6 at 111,246,374 bp
  • T to C, chromosome 6 at 113,561,716 bp
  • T to A, chromosome 7 at 3,239,924 bp
  • C to T, chromosome 7 at 6,393,442 bp
  • A to G, chromosome 7 at 11,164,978 bp
  • A to T, chromosome 7 at 13,029,480 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • C to T, chromosome 7 at 44,775,442 bp
  • C to T, chromosome 7 at 67,004,430 bp
  • T to C, chromosome 7 at 102,446,593 bp
  • G to A, chromosome 8 at 128,468,467 bp
  • T to A, chromosome 9 at 15,311,981 bp
  • A to G, chromosome 9 at 19,566,742 bp
  • G to A, chromosome 9 at 27,309,478 bp
  • T to A, chromosome 11 at 23,384,499 bp
  • T to C, chromosome 12 at 4,134,558 bp
  • T to C, chromosome 12 at 59,094,168 bp
  • T to C, chromosome 13 at 14,637,827 bp
  • C to T, chromosome 13 at 42,155,430 bp
  • G to T, chromosome 13 at 43,401,575 bp
  • A to T, chromosome 14 at 31,067,706 bp
  • C to T, chromosome 14 at 54,468,366 bp
  • T to G, chromosome 15 at 80,247,959 bp
  • G to T, chromosome 15 at 98,909,263 bp
  • A to G, chromosome 15 at 99,751,253 bp
  • C to T, chromosome 16 at 59,119,664 bp
  • A to G, chromosome 17 at 23,345,223 bp
  • G to T, chromosome 17 at 32,306,560 bp
  • T to C, chromosome 17 at 32,321,514 bp
  • C to T, chromosome 17 at 33,999,816 bp
  • A to G, chromosome 17 at 48,360,396 bp
  • C to T, chromosome 18 at 5,046,909 bp
  • T to C, chromosome 18 at 79,086,681 bp
  • C to T, chromosome 19 at 55,912,631 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4379 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041677-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.