Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4411Btlr/Mmmh
Stock Number:
041693-MU
Citation ID:
RRID:MMRRC_041693-MU
Other Names:
R4411 (G1), C57BL/6J-MtgxR4411Btlr
Major Collection:

Strain Information

Npr3
Name: natriuretic peptide receptor 3
Synonyms: Nppc receptor, lgj, longjohn, NPR-C, B430320C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18162
VEGA: 15
HGNC: HGNC:7945
Homologene: 699
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Prdm5
Name: PR domain containing 5
Synonyms: 6530401I24Rik, E130112L17Rik, PFM2, 4432417F03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70779
HGNC: HGNC:9349
Homologene: 10274
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Mdm2
Name: transformed mouse 3T3 cell double minute 2
Synonyms: Mdm-2, 1700007J15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17246
HGNC: HGNC:6973
Homologene: 1793
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Galnt5
Name: polypeptide N-acetylgalactosaminyltransferase 5
Synonyms: ppGaNTase-T5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241391
HGNC: HGNC:4127
Homologene: 8733
Adcy4
Name: adenylate cyclase 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 104110
VEGA: 14
HGNC: HGNC:235
Homologene: 23149
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: eyem02Jus, heb, QBRICK, crf11, eyes2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Klhl12
Name: kelch-like 12
Synonyms: C3ip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240756
Homologene: 23317
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
Tpd52l1
Name: tumor protein D52-like 1
Synonyms: D53
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21987
VEGA: 10
Homologene: 2468
Gpc6
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 23888
HGNC: HGNC:4454
Homologene: 55922
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Brd8
Name: bromodomain containing 8
Synonyms: p120, SMAP, 2610007E11Rik, 4432404P07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78656
Homologene: 41790
Pnpla7
Name: patatin-like phospholipase domain containing 7
Synonyms: E430013P11Rik, NRE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241274
Homologene: 62431
Tnfrsf25
Name: tumor necrosis factor receptor superfamily, member 25
Synonyms: WSL-1, Wsl, APO-3, TR3, DDR3, WSL-LR, LARD, TRAMP, DR3, Tnfrsf12
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 85030
Homologene: 13202
Galnt3
Name: polypeptide N-acetylgalactosaminyltransferase 3
Synonyms: ppGaNTase-T3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14425
HGNC: HGNC:4125
Homologene: 55827
Lcp2
Name: lymphocyte cytosolic protein 2
Synonyms: SLP-76, twm, SLP76, m1Khoe
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16822
HGNC: HGNC:6529
Homologene: 4065
Usp2
Name: ubiquitin specific peptidase 2
Synonyms: ubp41, B930035K21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53376
Homologene: 3098
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Taf5
Name: TATA-box binding protein associated factor 5
Synonyms: 6330528C20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226182
VEGA: 19
Homologene: 5064
Lmntd1
Name: lamin tail domain containing 1
Synonyms: Lmna-rs1, 4933403M22Rik, Ifltd1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74071
Homologene: 69453
Pcdhb5
Name: protocadherin beta 5
Synonyms: Pcdhb4A, PcdhbE
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93876
HGNC: HGNC:8689
Homologene: 75103
Fbxo44
Name: F-box protein 44
Synonyms: Fbx6a, FBX30, FBG3, Fbxo6a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230903
Homologene: 13232
Duox1
Name: dual oxidase 1
Synonyms: NOXEF1, THOX1, LNOX1, 9930101G15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Abca9
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Pnpla8
Name: patatin-like phospholipase domain containing 8
Synonyms: 1200006O19Rik, iPLA2 gamma
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67452
Homologene: 12136
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Trmt1l
Name: tRNA methyltransferase 1 like
Synonyms: Trm1-like, 1190005F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98685
Homologene: 12801
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Vmn2r58
Name: vomeronasal 2, receptor 58
Synonyms: EG628422
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628422
Ndor1
Name: NADPH dependent diflavin oxidoreductase 1
Synonyms: NR1, 4930447P04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78797
Homologene: 7144
Rab34
Name: RAB34, member RAS oncogene family
Synonyms: Rah1, Narr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19376
Homologene: 12908
Pde3b
Name: phosphodiesterase 3B, cGMP-inhibited
Synonyms: 9830102A01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18576
HGNC: HGNC:8779
Homologene: 709
Vmn1r115
Name: vomeronasal 1 receptor 115
Synonyms: Gm8549
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667273
Homologene: 104166
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Zfp455
Name: zinc finger protein 455
Synonyms: Rslcan-10, 3732412P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218311
Homologene: 110878
Ift88
Name: intraflagellar transport 88
Synonyms: Tg737, polaris, Oak Ridge polycystic kidneys, orpk, IFT88, fxo, TgN737Rpw, Tg737Rpw, Ttc10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21821
Homologene: 4761
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625109
Homologene: 129606
Vmn2r50
Name: vomeronasal 2, receptor 50
Synonyms: EG434117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434117
Homologene: 113703
Trim63
Name: tripartite motif-containing 63
Synonyms: MuRF1, Rnf28
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433766
Homologene: 41878
Ubxn6
Name: UBX domain protein 6
Synonyms: 2210415J11Rik, 1200008L11Rik, Ubxdc2, Ubxd1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66530
Homologene: 11538
Bsnd
Name: barttin CLCNK type accessory beta subunit
Synonyms: Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140475
Homologene: 14291
Spmip10
Name: sperm microtubule inner protein 10
Synonyms: 1700065I17Rik, Tex43
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67343
Homologene: 77918
Smpd5
Name: sphingomyelin phosphodiesterase 5
Synonyms: Gm10345
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 100503915
Homologene: 132205
Isoc2b
Name: isochorismatase domain containing 2b
Synonyms: 0610042E07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67441
Homologene: 85975
Tas2r114
Name: taste receptor, type 2, member 114
Synonyms: Tas2r14, T2R14, mGR14, mt2r46
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387346
Homologene: 128355
Mrgprx3-ps
Name: MAS-related GPR, member X3, pseudogene
Synonyms: LOC269919, Gm660, Gm19419
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100502859
Igkv12-46
Name: immunoglobulin kappa variable 12-46
Synonyms: Gm16849
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692245
HGNC: HGNC:5735
Atxn7l1os1
Name: ataxin 7-like 1, opposite strand 1
Synonyms: Gm11052
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Ighv1-76
Name: immunoglobulin heavy variable 1-76
Synonyms: Gm16813
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100775174
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 87,436,860 bp
  • T to C, chromosome 1 at 134,485,810 bp
  • G to A, chromosome 1 at 151,452,154 bp
  • T to C, chromosome 1 at 156,630,082 bp
  • G to A, chromosome 2 at 25,051,704 bp
  • G to A, chromosome 2 at 25,248,480 bp
  • T to C, chromosome 2 at 57,999,195 bp
  • A to G, chromosome 2 at 66,095,954 bp
  • C to T, chromosome 2 at 76,730,289 bp
  • T to C, chromosome 2 at 76,742,070 bp
  • T to C, chromosome 2 at 94,342,753 bp
  • G to A, chromosome 2 at 122,337,634 bp
  • A to T, chromosome 2 at 168,661,933 bp
  • T to C, chromosome 4 at 82,963,244 bp
  • C to T, chromosome 4 at 106,486,671 bp
  • A to G, chromosome 4 at 134,323,219 bp
  • A to G, chromosome 4 at 137,562,224 bp
  • A to T, chromosome 4 at 143,133,670 bp
  • G to A, chromosome 4 at 148,153,608 bp
  • G to A, chromosome 4 at 152,118,386 bp
  • T to A, chromosome 6 at 65,901,787 bp
  • G to A, chromosome 6 at 69,764,946 bp
  • G to T, chromosome 6 at 70,588,563 bp
  • C to T, chromosome 6 at 131,689,622 bp
  • C to A, chromosome 6 at 132,778,009 bp
  • A to G, chromosome 6 at 145,427,277 bp
  • A to T, chromosome 7 at 4,849,434 bp
  • A to C, chromosome 7 at 10,050,308 bp
  • T to C, chromosome 7 at 19,182,401 bp
  • C to T, chromosome 7 at 20,844,282 bp
  • T to A, chromosome 7 at 41,861,936 bp
  • T to C, chromosome 7 at 47,309,998 bp
  • T to A, chromosome 7 at 49,398,109 bp
  • GTGATGATGATGATGATGATGATGATG to GTGATGATGATGATGATGATGATG, chromosome 7 at 114,534,749 bp
  • T to C, chromosome 8 at 13,246,114 bp
  • T to C, chromosome 9 at 44,091,063 bp
  • T to C, chromosome 10 at 31,379,319 bp
  • T to C, chromosome 10 at 68,096,689 bp
  • A to T, chromosome 10 at 117,709,789 bp
  • A to G, chromosome 10 at 130,452,600 bp
  • T to A, chromosome 11 at 34,087,173 bp
  • T to A, chromosome 11 at 78,188,766 bp
  • T to C, chromosome 11 at 110,151,955 bp
  • G to T, chromosome 12 at 33,194,887 bp
  • T to C, chromosome 12 at 44,283,442 bp
  • A to T, chromosome 12 at 115,848,111 bp
  • A to T, chromosome 13 at 67,207,325 bp
  • A to G, chromosome 13 at 76,127,504 bp
  • T to C, chromosome 14 at 55,769,443 bp
  • A to G, chromosome 14 at 57,477,979 bp
  • T to C, chromosome 14 at 117,951,178 bp
  • G to C, chromosome 15 at 11,905,149 bp
  • G to T, chromosome 15 at 76,294,912 bp
  • C to A, chromosome 16 at 8,708,914 bp
  • A to G, chromosome 17 at 23,810,468 bp
  • C to T, chromosome 17 at 34,728,864 bp
  • A to T, chromosome 17 at 56,069,303 bp
  • T to C, chromosome 17 at 87,717,604 bp
  • C to A, chromosome 18 at 34,623,444 bp
  • T to C, chromosome 18 at 37,321,997 bp
  • A to G, chromosome 18 at 56,594,648 bp
  • T to C, chromosome 18 at 74,698,274 bp
  • T to A, chromosome 19 at 47,071,014 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4411 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041693-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.