Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4411Btlr/Mmmh
Stock Number:
041693-MU
Citation ID:
RRID:MMRRC_041693-MU
Other Names:
R4411 (G1), C57BL/6J-MtgxR4411Btlr
Major Collection:

Strain Information

Npr3
Name: natriuretic peptide receptor 3
Synonyms: Nppc receptor, lgj, longjohn, NPR-C, B430320C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18162
VEGA: 15
HGNC: HGNC:7945
Homologene: 699
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Prdm5
Name: PR domain containing 5
Synonyms: 6530401I24Rik, E130112L17Rik, PFM2, 4432417F03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70779
HGNC: HGNC:9349
Homologene: 10274
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 87,436,860 bp
  • T to C, chromosome 1 at 134,485,810 bp
  • G to A, chromosome 1 at 151,452,154 bp
  • T to C, chromosome 1 at 156,630,082 bp
  • G to A, chromosome 2 at 25,051,704 bp
  • G to A, chromosome 2 at 25,248,480 bp
  • T to C, chromosome 2 at 57,999,195 bp
  • A to G, chromosome 2 at 66,095,954 bp
  • C to T, chromosome 2 at 76,730,289 bp
  • T to C, chromosome 2 at 76,742,070 bp
  • T to C, chromosome 2 at 94,342,753 bp
  • G to A, chromosome 2 at 122,337,634 bp
  • A to T, chromosome 2 at 168,661,933 bp
  • T to C, chromosome 4 at 82,963,244 bp
  • C to T, chromosome 4 at 106,486,671 bp
  • A to G, chromosome 4 at 134,323,219 bp
  • A to G, chromosome 4 at 137,562,224 bp
  • A to T, chromosome 4 at 143,133,670 bp
  • G to A, chromosome 4 at 148,153,608 bp
  • G to A, chromosome 4 at 152,118,386 bp
  • T to A, chromosome 6 at 65,901,787 bp
  • G to A, chromosome 6 at 69,764,946 bp
  • G to T, chromosome 6 at 70,588,563 bp
  • C to T, chromosome 6 at 131,689,622 bp
  • C to A, chromosome 6 at 132,778,009 bp
  • A to G, chromosome 6 at 145,427,277 bp
  • A to T, chromosome 7 at 4,849,434 bp
  • A to C, chromosome 7 at 10,050,308 bp
  • T to C, chromosome 7 at 19,182,401 bp
  • C to T, chromosome 7 at 20,844,282 bp
  • T to A, chromosome 7 at 41,861,936 bp
  • T to C, chromosome 7 at 47,309,998 bp
  • T to A, chromosome 7 at 49,398,109 bp
  • GTGATGATGATGATGATGATGATGATG to GTGATGATGATGATGATGATGATG, chromosome 7 at 114,534,749 bp
  • T to C, chromosome 8 at 13,246,114 bp
  • T to C, chromosome 9 at 44,091,063 bp
  • T to C, chromosome 10 at 31,379,319 bp
  • T to C, chromosome 10 at 68,096,689 bp
  • A to T, chromosome 10 at 117,709,789 bp
  • A to G, chromosome 10 at 130,452,600 bp
  • T to A, chromosome 11 at 34,087,173 bp
  • T to A, chromosome 11 at 78,188,766 bp
  • T to C, chromosome 11 at 110,151,955 bp
  • G to T, chromosome 12 at 33,194,887 bp
  • T to C, chromosome 12 at 44,283,442 bp
  • A to T, chromosome 12 at 115,848,111 bp
  • A to T, chromosome 13 at 67,207,325 bp
  • A to G, chromosome 13 at 76,127,504 bp
  • T to C, chromosome 14 at 55,769,443 bp
  • A to G, chromosome 14 at 57,477,979 bp
  • T to C, chromosome 14 at 117,951,178 bp
  • G to C, chromosome 15 at 11,905,149 bp
  • G to T, chromosome 15 at 76,294,912 bp
  • C to A, chromosome 16 at 8,708,914 bp
  • A to G, chromosome 17 at 23,810,468 bp
  • C to T, chromosome 17 at 34,728,864 bp
  • A to T, chromosome 17 at 56,069,303 bp
  • T to C, chromosome 17 at 87,717,604 bp
  • C to A, chromosome 18 at 34,623,444 bp
  • T to C, chromosome 18 at 37,321,997 bp
  • A to G, chromosome 18 at 56,594,648 bp
  • T to C, chromosome 18 at 74,698,274 bp
  • T to A, chromosome 19 at 47,071,014 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4411 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041693-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.