Strain Name:
C57BL/6J-MtgxR4493Btlr/Mmmh
Stock Number:
041748-MU
Citation ID:
RRID:MMRRC_041748-MU
Other Names:
R4493 (G1), C57BL/6J-MtgxR4493Btlr
Major Collection:

Gene Information

Nes
Name: nestin
Synonyms: RC2, Ifaprc2, ESTM46, Marc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 54524
Homologene: 10301
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Prep
Name: prolyl endopeptidase
Synonyms: prolyl oligopeptidase, D10Wsu136e, Pop
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100683
Homologene: 39246
Mcph1
Name: microcephaly, primary autosomal recessive 1
Synonyms: D030046N04Rik, 5430437K10Rik, BRIT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244329
HGNC: HGNC:6954
Homologene: 32586
Pold1
Name: polymerase (DNA directed), delta 1, catalytic subunit
Synonyms: 125kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18971
HGNC: HGNC:9175
Homologene: 2014
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: 2610301F02Rik, CAMDI, ENSMUSG00000075261
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 545428
Homologene: 52149
Glt8d2
Name: glycosyltransferase 8 domain containing 2
Synonyms: 1110021D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 74782
Homologene: 41826
Pgam1
Name: phosphoglycerate mutase 1
Synonyms: 2310050F24Rik, Pgam-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18648
VEGA: 19
HGNC: HGNC:8888
Homologene: 37647
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Ip3r3, tf, Itpr-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Gtf3c2
Name: general transcription factor IIIC, polypeptide 2, beta
Synonyms: TFIIIC110, TFIIIC-BETA, 2610510G03Rik, 1300004C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 71752
HGNC: HGNC:4665
Homologene: 37490
Nfkb2
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonyms: NF kappaB2, p52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18034
VEGA: 19
HGNC: HGNC:7795
Homologene: 1873
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: smrl, alpha1A, Cacnl1a4, SCA6, nmf352, Ccha1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Xkrx
Name: X-linked Kx blood group related, X-linked
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 331524
Homologene: 77932
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545370
Homologene: 23741
Cmya5
Name: cardiomyopathy associated 5
Synonyms: 2310076E16Rik, Myospryn, 2310076E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 76469
VEGA: 13
Homologene: 137367
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: Fam38b, Piezo2, 9030411M15Rik, Fam38b2, 9430028L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 667742
Homologene: 49695
Dhx36
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 36
Synonyms: Ddx36, 2810407E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 72162
Homologene: 6356
Ppih
Name: peptidyl prolyl isomerase H
Synonyms: CYP-20, 2010111B15Rik, rotamase H, 4833408F11Rik, 1100001J08Rik, cyclophilin H, D4Wsu43e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 66101
Homologene: 38172
Cngb3
Name: cyclic nucleotide gated channel beta 3
Synonyms: Cngbeta2, CCNC2, CNG6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 30952
HGNC: HGNC:2153
Homologene: 40908
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 22371
Homologene: 466
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241589
Homologene: 115928
Poteg
Name: POTE ankyrin domain family, member G
Synonyms: 4930456F22Rik, 4921537P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 70952
Homologene: 134158
Rtp4
Name: receptor transporter protein 4
Synonyms: 5830458K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 67775
Homologene: 56944
Ccdc146
Name: coiled-coil domain containing 146
Synonyms: 4930528G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 75172
Homologene: 67159
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, Cav2.2, alpha(1B)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Tma16
Name: translation machinery associated 16
Synonyms: 1810029B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 66282
Homologene: 10146
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 279029
Homologene: 19586
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 268527
Homologene: 8780
Mrc2
Name: mannose receptor, C type 2
Synonyms: Endo180, novel lectin, uPARAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17534
Homologene: 4408
Hspa4l
Name: heat shock protein 4 like
Synonyms: 94kDa, APG-1, Osp94
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18415
Homologene: 22610
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 211468
Homologene: 14332
Vmn1r230
Name: vomeronasal 1 receptor 230
Synonyms: V1re8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 171231
Homologene: 136306
Zfp946
Name: zinc finger protein 946
Synonyms: 1300003B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 74149
Ctnna2
Name: catenin (cadherin associated protein), alpha 2
Synonyms: Catna, Catna2, alpha(N)-catenin, alpha N-catenin, chp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Tas2r129
Name: taste receptor, type 2, member 129
Synonyms: mGR29, mt2r60, T2R29, Tas2r29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 387354
Homologene: 130074
Naga
Name: N-acetyl galactosaminidase, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 17939
VEGA: 15
HGNC: HGNC:7631
Homologene: 221
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 105387
Homologene: 138093
Tprn
Name: taperin
Synonyms: C430004E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 97031
Homologene: 52156
Prlhr
Name: prolactin releasing hormone receptor
Synonyms: GR3, LOC226278, PrRPR, Gpr10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226278
VEGA: 19
HGNC: HGNC:4464
Homologene: 3134
1700111E14Rik
Name: RIKEN cDNA 1700111E14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Maats1
Name: MYCBP-associated, testis expressed 1
Synonyms: Spata26, 4932425I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 320214
Homologene: 33470
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 150,701,899 bp
  • T to C, chromosome 2 at 24,652,938 bp
  • T to C, chromosome 2 at 25,268,892 bp
  • A to G, chromosome 2 at 26,946,626 bp
  • A to G, chromosome 2 at 77,132,297 bp
  • T to C, chromosome 2 at 104,256,339 bp
  • A to G, chromosome 3 at 40,768,002 bp
  • A to T, chromosome 3 at 62,488,504 bp
  • A to G, chromosome 3 at 87,976,813 bp
  • A to G, chromosome 3 at 103,585,630 bp
  • C to A, chromosome 4 at 19,367,778 bp
  • A to T, chromosome 4 at 119,310,845 bp
  • T to C, chromosome 5 at 21,303,193 bp
  • T to C, chromosome 5 at 31,172,800 bp
  • T to C, chromosome 5 at 115,594,144 bp
  • T to C, chromosome 5 at 144,831,048 bp
  • T to C, chromosome 6 at 36,974,861 bp
  • A to G, chromosome 6 at 76,981,848 bp
  • G to A, chromosome 6 at 125,655,036 bp
  • A to G, chromosome 6 at 132,951,354 bp
  • A to G, chromosome 7 at 44,537,708 bp
  • T to A, chromosome 8 at 18,631,736 bp
  • T to C, chromosome 8 at 27,480,097 bp
  • C to T, chromosome 8 at 66,484,171 bp
  • C to T, chromosome 8 at 84,580,194 bp
  • T to C, chromosome 10 at 45,120,819 bp
  • T to A, chromosome 10 at 82,664,713 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • C to A, chromosome 12 at 16,698,610 bp
  • A to G, chromosome 13 at 4,079,071 bp
  • G to A, chromosome 13 at 13,635,383 bp
  • T to C, chromosome 13 at 93,094,065 bp
  • A to G, chromosome 15 at 82,332,514 bp
  • A to T, chromosome 16 at 23,610,077 bp
  • T to C, chromosome 16 at 38,341,768 bp
  • T to A, chromosome 17 at 20,846,601 bp
  • T to A, chromosome 17 at 22,451,086 bp
  • A to G, chromosome 17 at 27,104,612 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 18 at 36,954,591 bp
  • T to C, chromosome 18 at 63,114,063 bp
  • C to T, chromosome 19 at 41,915,776 bp
  • A to G, chromosome 19 at 46,308,439 bp
  • A to T, chromosome 19 at 60,467,081 bp
  • T to C, chromosome X at 134,150,996 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4493 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041748-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.