Strain Name:
C57BL/6J-MtgxR4593Btlr/Mmmh
Stock Number:
041809-MU
Citation ID:
RRID:MMRRC_041809-MU
Other Names:
R4593 (G1), C57BL/6J-MtgxR4593Btlr
Major Collection:

Strain Information

Cd86
Name: CD86 antigen
Synonyms: MB7-2, Ly58, Cd28l2, B70, B7.2, B7-2, Ly-58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Dgat1
Name: diacylglycerol O-acyltransferase 1
Synonyms: D15Ertd23e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13350
HGNC: HGNC:2843
Homologene: 7688
Nub1
Name: negative regulator of ubiquitin-like proteins 1
Synonyms: NY-REN-18, BS4, 4931404D21Rik, 6330412F12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53312
Homologene: 41108
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Med13l
Name: mediator complex subunit 13-like
Synonyms: 9030618F05Rik, Trap240L, Thrap2, 6330591G05Rik, 2210413I17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, mindbomb, Mib, mind bomb-1, skeletrophin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: Bat2l2, 9630039I18Rik, 1810043M20Rik, Bat2d
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Unk
Name: unkempt family zinc finger
Synonyms: Zc3h5, B230379M23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217331
Homologene: 18194
Atxn3
Name: ataxin 3
Synonyms: Mjd, Sca3, Atx3, ataxin-3, MJD1, 2210008M02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110616
HGNC: HGNC:7106
Homologene: 3658
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Rasa1
Name: RAS p21 protein activator 1
Synonyms: Gap, p120-rasGAP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218397
HGNC: HGNC:9871
Homologene: 2168
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: Ta3, talpid3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Parp11
Name: poly (ADP-ribose) polymerase family, member 11
Synonyms: 5330431N24Rik, HIN1L
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101187
HGNC: HGNC:1186
Homologene: 10680
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: 2010309L07Rik, vp165, IRAP, 4732490P18Rik, gp160
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Col9a3
Name: collagen, type IX, alpha 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12841
HGNC: HGNC:2219
Homologene: 20438
Vmn1r59
Name: vomeronasal 1 receptor 59
Synonyms: V1rd10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404284
Homologene: 41799
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: OTTMUSG00000005786, LOC380698
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17922
HGNC: HGNC:7607
Homologene: 81947
Npas3
Name: neuronal PAS domain protein 3
Synonyms: bHLHe12, 4930423H22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27386
VEGA: 12
Homologene: 8461
Npr2
Name: natriuretic peptide receptor 2
Synonyms: cn, guanylyl cyclase-B, pwe
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Vmn1r194
Name: vomeronasal 1 receptor 194
Synonyms: Gm11294
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 626299
Homologene: 110880
Cyp2s1
Name: cytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms: 1200011C15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74134
Homologene: 75274
Or9g20
Name: olfactory receptor family 9 subfamily G member 20
Synonyms: Olfr1016, GA_x6K02T2Q125-47278889-47277960, MOR213-9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257915
Homologene: 83133
Nexn
Name: nexilin
Synonyms: 1110046H09Rik, nF actin binding protein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68810
Homologene: 44892
Or1e33
Name: olfactory receptor family 1 subfamily E member 33
Synonyms: MOR135-7, Olfr393, GA_x6K02T2P1NL-4004140-4003208
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259010
Homologene: 79335
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Panx2
Name: pannexin 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406218
HGNC: HGNC:8600
Homologene: 14155
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, Kv4.3, potassium channel Kv4.3L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Zbtb24
Name: zinc finger and BTB domain containing 24
Synonyms: ZNF450
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268294
VEGA: 10
Homologene: 8870
Ldhd
Name: lactate dehydrogenase D
Synonyms: 4733401P21Rik, D8Bwg1320e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52815
Homologene: 5536
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Mkrn3
Name: makorin, ring finger protein, 3
Synonyms: D7H15S9-1, Zfp127
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22652
HGNC: HGNC:7114
Homologene: 4143
Gpr149
Name: G protein-coupled receptor 149
Synonyms: R35, 9630018L10Rik, Ieda, PGR10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229357
Homologene: 16359
Vmn1r88
Name: vomeronasal 1 receptor, 88
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312474
Homologene: 74345
Sva
Name: seminal vesicle antigen
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20939
Emp3
Name: epithelial membrane protein 3
Synonyms: HNMP-1, Ymp, H4, H-4, MI-35
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13732
HGNC: HGNC:3335
Homologene: 1090
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 84,695,728 bp
  • T to C, chromosome 1 at 162,697,532 bp
  • A to G, chromosome 2 at 85,799,664 bp
  • A to G, chromosome 2 at 180,608,449 bp
  • A to T, chromosome 3 at 62,602,730 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • T to A, chromosome 3 at 152,252,916 bp
  • A to G, chromosome 4 at 43,647,323 bp
  • T to C, chromosome 4 at 58,091,944 bp
  • A to G, chromosome 5 at 24,709,121 bp
  • T to C, chromosome 5 at 118,742,560 bp
  • T to C, chromosome 6 at 42,042,658 bp
  • T to C, chromosome 6 at 127,474,299 bp
  • A to T, chromosome 7 at 5,454,687 bp
  • A to G, chromosome 7 at 13,177,842 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAGCAG, chromosome 7 at 25,816,442 bp
  • A to G, chromosome 7 at 45,919,353 bp
  • C to T, chromosome 7 at 62,418,804 bp
  • G to A, chromosome 7 at 105,715,446 bp
  • G to T, chromosome 8 at 55,940,881 bp
  • T to C, chromosome 8 at 111,629,364 bp
  • G to T, chromosome 9 at 53,453,594 bp
  • A to G, chromosome 10 at 41,451,957 bp
  • G to T, chromosome 11 at 8,901,253 bp
  • A to C, chromosome 11 at 59,133,249 bp
  • T to A, chromosome 11 at 73,847,314 bp
  • A to G, chromosome 11 at 103,498,969 bp
  • T to C, chromosome 11 at 116,049,056 bp
  • A to T, chromosome 12 at 54,068,497 bp
  • G to T, chromosome 12 at 71,164,546 bp
  • A to T, chromosome 12 at 71,164,547 bp
  • A to T, chromosome 12 at 101,923,177 bp
  • T to C, chromosome 12 at 114,583,604 bp
  • C to T, chromosome 13 at 21,984,453 bp
  • T to A, chromosome 13 at 22,244,291 bp
  • T to C, chromosome 13 at 63,068,092 bp
  • T to C, chromosome 13 at 85,238,221 bp
  • C to A, chromosome 15 at 76,504,689 bp
  • T to C, chromosome 15 at 89,067,915 bp
  • A to G, chromosome 16 at 36,606,556 bp
  • T to C, chromosome 16 at 90,787,444 bp
  • A to G, chromosome 17 at 17,579,027 bp
  • T to C, chromosome 18 at 10,768,191 bp
  • A to G, chromosome 18 at 32,013,375 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4593 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041809-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.