Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4593Btlr/Mmmh
Stock Number:
041809-MU
Citation ID:
RRID:MMRRC_041809-MU
Other Names:
R4593 (G1), C57BL/6J-MtgxR4593Btlr
Major Collection:

Strain Information

Cd86
Name: CD86 antigen
Synonyms: B7-2, MB7-2, B70, Ly-58, Cd28l2, B7.2, Ly58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Dgat1
Name: diacylglycerol O-acyltransferase 1
Synonyms: D15Ertd23e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13350
HGNC: HGNC:2843
Homologene: 7688
Nub1
Name: negative regulator of ubiquitin-like proteins 1
Synonyms: BS4, NY-REN-18, 4931404D21Rik, 6330412F12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53312
Homologene: 41108
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 84,695,728 bp
  • T to C, chromosome 1 at 162,697,532 bp
  • A to G, chromosome 2 at 85,799,664 bp
  • A to G, chromosome 2 at 180,608,449 bp
  • A to T, chromosome 3 at 62,602,730 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • T to A, chromosome 3 at 152,252,916 bp
  • A to G, chromosome 4 at 43,647,323 bp
  • T to C, chromosome 4 at 58,091,944 bp
  • A to G, chromosome 5 at 24,709,121 bp
  • T to C, chromosome 5 at 118,742,560 bp
  • T to C, chromosome 6 at 42,042,658 bp
  • T to C, chromosome 6 at 127,474,299 bp
  • A to T, chromosome 7 at 5,454,687 bp
  • A to G, chromosome 7 at 13,177,842 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAGCAG, chromosome 7 at 25,816,442 bp
  • A to G, chromosome 7 at 45,919,353 bp
  • C to T, chromosome 7 at 62,418,804 bp
  • G to A, chromosome 7 at 105,715,446 bp
  • G to T, chromosome 8 at 55,940,881 bp
  • T to C, chromosome 8 at 111,629,364 bp
  • G to T, chromosome 9 at 53,453,594 bp
  • A to G, chromosome 10 at 41,451,957 bp
  • G to T, chromosome 11 at 8,901,253 bp
  • A to C, chromosome 11 at 59,133,249 bp
  • T to A, chromosome 11 at 73,847,314 bp
  • A to G, chromosome 11 at 103,498,969 bp
  • T to C, chromosome 11 at 116,049,056 bp
  • A to T, chromosome 12 at 54,068,497 bp
  • G to T, chromosome 12 at 71,164,546 bp
  • A to T, chromosome 12 at 71,164,547 bp
  • A to T, chromosome 12 at 101,923,177 bp
  • T to C, chromosome 12 at 114,583,604 bp
  • C to T, chromosome 13 at 21,984,453 bp
  • T to A, chromosome 13 at 22,244,291 bp
  • T to C, chromosome 13 at 63,068,092 bp
  • T to C, chromosome 13 at 85,238,221 bp
  • C to A, chromosome 15 at 76,504,689 bp
  • T to C, chromosome 15 at 89,067,915 bp
  • A to G, chromosome 16 at 36,606,556 bp
  • T to C, chromosome 16 at 90,787,444 bp
  • A to G, chromosome 17 at 17,579,027 bp
  • T to C, chromosome 18 at 10,768,191 bp
  • A to G, chromosome 18 at 32,013,375 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4593 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041809-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.