Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4615Btlr/Mmmh
Stock Number:
041826-MU
Citation ID:
RRID:MMRRC_041826-MU
Other Names:
R4615 (G1), C57BL/6J-MtgxR4615Btlr
Major Collection:

Strain Information

Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
S100a1
Name: S100 calcium binding protein A1
Synonyms: S100a, S100
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20193
Homologene: 4566
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: mTAFII140, 4933439M23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Gng2
Name: guanine nucleotide binding protein (G protein), gamma 2
Synonyms: 1110003P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14702
HGNC: HGNC:4404
Homologene: 40715
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 55,698,134 bp
  • T to C, chromosome 1 at 71,330,334 bp
  • C to A, chromosome 1 at 71,346,660 bp
  • G to A, chromosome 2 at 9,952,090 bp
  • A to G, chromosome 2 at 13,428,749 bp
  • A to G, chromosome 2 at 76,766,875 bp
  • A to G, chromosome 2 at 79,662,382 bp
  • G to T, chromosome 2 at 143,795,969 bp
  • C to T, chromosome 2 at 154,262,136 bp
  • T to C, chromosome 2 at 163,320,647 bp
  • T to C, chromosome 2 at 180,731,906 bp
  • T to C, chromosome 3 at 75,521,091 bp
  • A to G, chromosome 3 at 90,511,255 bp
  • A to G, chromosome 3 at 93,774,032 bp
  • T to C, chromosome 4 at 3,585,156 bp
  • A to G, chromosome 4 at 63,363,299 bp
  • A to T, chromosome 4 at 99,031,361 bp
  • T to C, chromosome 4 at 118,754,137 bp
  • A to T, chromosome 4 at 144,158,329 bp
  • A to G, chromosome 5 at 21,972,872 bp
  • A to T, chromosome 5 at 45,687,399 bp
  • A to C, chromosome 5 at 72,604,774 bp
  • G to T, chromosome 5 at 110,789,046 bp
  • A to G, chromosome 5 at 129,022,098 bp
  • A to G, chromosome 5 at 138,266,263 bp
  • G to T, chromosome 5 at 150,518,063 bp
  • C to G, chromosome 6 at 142,689,107 bp
  • A to T, chromosome 7 at 12,582,302 bp
  • T to A, chromosome 7 at 26,201,125 bp
  • T to C, chromosome 7 at 45,148,788 bp
  • T to C, chromosome 7 at 81,320,737 bp
  • T to C, chromosome 7 at 86,694,728 bp
  • C to T, chromosome 7 at 127,577,620 bp
  • A to G, chromosome 8 at 13,242,250 bp
  • A to T, chromosome 8 at 99,279,622 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 105,695,074 bp
  • A to T, chromosome 9 at 51,948,645 bp
  • A to T, chromosome 9 at 121,916,098 bp
  • T to A, chromosome 10 at 23,941,365 bp
  • C to A, chromosome 10 at 26,981,524 bp
  • C to T, chromosome 11 at 30,834,287 bp
  • T to C, chromosome 12 at 72,902,485 bp
  • G to T, chromosome 12 at 90,729,821 bp
  • T to C, chromosome 12 at 115,952,660 bp
  • A to G, chromosome 13 at 38,191,632 bp
  • A to T, chromosome 13 at 73,607,738 bp
  • C to T, chromosome 13 at 81,494,569 bp
  • C to T, chromosome 14 at 19,891,327 bp
  • T to C, chromosome 14 at 24,158,168 bp
  • G to A, chromosome 14 at 52,312,750 bp
  • A to G, chromosome 15 at 6,491,463 bp
  • T to C, chromosome 15 at 73,695,736 bp
  • T to C, chromosome 15 at 76,596,937 bp
  • A to T, chromosome 16 at 15,663,074 bp
  • A to G, chromosome 16 at 58,456,094 bp
  • A to T, chromosome 17 at 35,013,881 bp
  • A to G, chromosome 17 at 66,413,951 bp
  • T to C, chromosome 18 at 19,971,488 bp
  • T to A, chromosome 18 at 20,682,763 bp
  • T to A, chromosome 18 at 37,308,500 bp
  • T to C, chromosome 18 at 53,714,841 bp
  • T to C, chromosome 18 at 64,553,099 bp
  • T to C, chromosome 19 at 5,029,264 bp
  • T to C, chromosome 19 at 41,943,683 bp
  • A to T, chromosome 19 at 59,022,216 bp
  • C to T, chromosome 19 at 61,175,926 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4615 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041826-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.