Strain Name:
C57BL/6J-MtgxR4615Btlr/Mmmh
Stock Number:
041826-MU
Citation ID:
RRID:MMRRC_041826-MU
Other Names:
R4615 (G1), C57BL/6J-MtgxR4615Btlr
Major Collection:

Strain Information

Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
S100a1
Name: S100 calcium binding protein A1
Synonyms: S100a, S100
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20193
Homologene: 4566
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: dxnph, DOXNPH, XRCC7, DNA-PK, DNAPDcs, slip, DNA-PKcs
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: mTAFII140, 4933439M23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Gng2
Name: guanine nucleotide binding protein (G protein), gamma 2
Synonyms: 1110003P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14702
HGNC: HGNC:4404
Homologene: 40715
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: Ssfa2, SPAG13, KRAP, CS1, CS-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70599
Homologene: 4912
Clptm1l
Name: CLPTM1-like
Synonyms: C130052I12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218335
VEGA: 13
Homologene: 12767
Vars1
Name: valyl-tRNA synthetase 1
Synonyms: Vars, D17H6S56E, G7a, Bat-6, Vars2, Bat6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22321
Homologene: 4587
Aldh16a1
Name: aldehyde dehydrogenase 16 family, member A1
Synonyms: 2410004H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69748
Homologene: 34938
Dsp
Name: desmoplakin
Synonyms: 2300002E22Rik, rul, DP, 5730453H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Cep120
Name: centrosomal protein 120
Synonyms: Ccdc100
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225523
VEGA: 18
Homologene: 27415
Pdcd10
Name: programmed cell death 10
Synonyms: 2410003B13Rik, CCM3, TF-1 cell apoptosis related protein-15, Tfa15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56426
HGNC: HGNC:8761
Homologene: 10505
Angptl3
Name: angiopoietin-like 3
Synonyms: hypl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30924
HGNC: HGNC:491
Homologene: 8499
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: 5730507H05Rik, Hcapg, MFT.M05.13
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54392
Homologene: 44071
Mplkipl1
Name: M-phase specific PLK1 intereacting protein like 1
Synonyms: Gm7102
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 633057
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Cubn
Name: cubilin
Synonyms: intrinsic factor-cobalamin receptor, D2Wsu88e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Shtn1
Name: shootin 1
Synonyms: 4930506M07Rik, shootin1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71653
VEGA: 19
Homologene: 41249
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pcdhb4
Name: protocadherin beta 4
Synonyms: PcdhbD, Pcdhb5A
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93875
HGNC: HGNC:8690
Homologene: 62176
Pcsk2
Name: proprotein convertase subtilisin/kexin type 2
Synonyms: Nec2, Nec-2, PC2, Phpp-2, prohormone convertase 2, 6330411F23Rik, SPC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18549
HGNC: HGNC:8744
Homologene: 37640
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Cyp2b9
Name: cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms: phenobarbitol inducible, type a, Cyp2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13094
HGNC: HGNC:2615
Homologene: 74933
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Gpr98, Mgr1, Mass1, VLGR1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Taar2
Name: trace amine-associated receptor 2
Synonyms: Gpr58
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209512
HGNC: HGNC:4514
Homologene: 110760
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: Sur2, SUR2B, SUR2A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Or10ak14
Name: olfactory receptor family 10 subfamily AK member 14
Synonyms: MOR259-4P, Olfr1524-ps1, MOR259-4P, GA_x6K02T2QD9B-18795136-18796077, Olfr1338, MOR259-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258259
Homologene: 115537
Plcl1
Name: phospholipase C-like 1
Synonyms: PRIP-1, C230017K02Rik, PLC-L
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227120
HGNC: HGNC:9063
Homologene: 38155
Bpifb9a
Name: BPI fold containing family B, member 9A
Synonyms: 4833413D08Rik, vomeromodulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71425
Homologene: 128535
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Vmn2r53
Name: vomeronasal 2, receptor 53
Synonyms: EG637908
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637908
Homologene: 104040
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Dsc3
Name: desmocollin 3
Synonyms: 5430426I24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13507
VEGA: 18
HGNC: HGNC:3037
Homologene: 1462
Dio2
Name: deiodinase, iodothyronine, type II
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13371
VEGA: 12
HGNC: HGNC:2884
Homologene: 621
Dcbld2
Name: discoidin, CUB and LCCL domain containing 2
Synonyms: CLCP1, Esdn, 1700055P21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73379
Homologene: 12499
Tgs1
Name: trimethylguanosine synthase 1
Synonyms: Ncoa6ip, D4Ertd800e, Pimt
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 116940
Homologene: 32608
Cnga1
Name: cyclic nucleotide gated channel alpha 1
Synonyms: Cncg
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12788
HGNC: HGNC:2148
Homologene: 55432
Gm5773
Name: predicted pseudogene 5773
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 436563
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: D330008N11Rik, Arh2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
C9
Name: complement component 9
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12279
HGNC: HGNC:1358
Homologene: 74406
Or14c39
Name: olfactory receptor family 14 subfamily C member 39
Synonyms: MOR220-2, GA_x6K02T2NHDJ-9425121-9424195, Olfr292
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258613
Homologene: 115526
Phkg2
Name: phosphorylase kinase, gamma 2 (testis)
Synonyms: 1500017I02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68961
HGNC: HGNC:8931
Homologene: 47915
Orm2
Name: orosomucoid 2
Synonyms: Orm-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18406
Homologene: 130632
Fdx1
Name: ferredoxin 1
Synonyms: ADRENODOXIN
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14148
VEGA: 9
HGNC: HGNC:3638
Homologene: 31216
Gal3st4
Name: galactose-3-O-sulfotransferase 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330217
Homologene: 11633
Slc17a9
Name: solute carrier family 17, member 9
Synonyms: Vnut, 1700019H03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228993
Homologene: 76562
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: D130029J02Rik, Rltpr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234695
Homologene: 128439
4930447C04Rik
Name: RIKEN cDNA 4930447C04 gene
Synonyms: Six6os1, Six6as
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75801
Homologene: 49922
Zar1l
Name: zygote arrest 1-like
Synonyms: LOC545824
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545824
Homologene: 85370
Tox2
Name: TOX high mobility group box family member 2
Synonyms: RxHMG1, LOC269389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269389
Homologene: 13155
Cyp8b1
Name: cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms: sterol 12-alpha-hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13124
HGNC: HGNC:2653
Homologene: 3233
Sall2
Name: spalt like transcription factor 2
Synonyms: Msal-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50524
Homologene: 9269
Slc29a2
Name: solute carrier family 29 (nucleoside transporters), member 2
Synonyms: HNP36, ENT2, Der12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13340
VEGA: 19
Homologene: 37493
Gpr20
Name: G protein-coupled receptor 20
Synonyms: A430106B11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239530
HGNC: HGNC:4475
Homologene: 3870
Zdhhc16
Name: zinc finger, DHHC domain containing 16
Synonyms: APH2, 1500015N03Rik, Ablphilin 2, Abl-philin 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74168
VEGA: 19
Homologene: 11377
Gm10269
Name: predicted gene 10269
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100040823
VEGA: 18
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CKLFH1, CHLFH1a, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Ighv1-82
Name: immunoglobulin heavy variable 1-82
Synonyms: Gm16747
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100775175
HGNC: HGNC:5553
Ran
Name: RAN, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19384
HGNC: HGNC:9846
Homologene: 68143
Gm4705
Name: predicted gene 4705
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100043876
Homologene: 105146
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 55,698,134 bp
  • T to C, chromosome 1 at 71,330,334 bp
  • C to A, chromosome 1 at 71,346,660 bp
  • G to A, chromosome 2 at 9,952,090 bp
  • A to G, chromosome 2 at 13,428,749 bp
  • A to G, chromosome 2 at 76,766,875 bp
  • A to G, chromosome 2 at 79,662,382 bp
  • G to T, chromosome 2 at 143,795,969 bp
  • C to T, chromosome 2 at 154,262,136 bp
  • T to C, chromosome 2 at 163,320,647 bp
  • T to C, chromosome 2 at 180,731,906 bp
  • T to C, chromosome 3 at 75,521,091 bp
  • A to G, chromosome 3 at 90,511,255 bp
  • A to G, chromosome 3 at 93,774,032 bp
  • T to C, chromosome 4 at 3,585,156 bp
  • A to G, chromosome 4 at 63,363,299 bp
  • A to T, chromosome 4 at 99,031,361 bp
  • T to C, chromosome 4 at 118,754,137 bp
  • A to T, chromosome 4 at 144,158,329 bp
  • A to G, chromosome 5 at 21,972,872 bp
  • A to T, chromosome 5 at 45,687,399 bp
  • A to C, chromosome 5 at 72,604,774 bp
  • G to T, chromosome 5 at 110,789,046 bp
  • A to G, chromosome 5 at 129,022,098 bp
  • A to G, chromosome 5 at 138,266,263 bp
  • G to T, chromosome 5 at 150,518,063 bp
  • C to G, chromosome 6 at 142,689,107 bp
  • A to T, chromosome 7 at 12,582,302 bp
  • T to A, chromosome 7 at 26,201,125 bp
  • T to C, chromosome 7 at 45,148,788 bp
  • T to C, chromosome 7 at 81,320,737 bp
  • T to C, chromosome 7 at 86,694,728 bp
  • C to T, chromosome 7 at 127,577,620 bp
  • A to G, chromosome 8 at 13,242,250 bp
  • A to T, chromosome 8 at 99,279,622 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 105,695,074 bp
  • A to T, chromosome 9 at 51,948,645 bp
  • A to T, chromosome 9 at 121,916,098 bp
  • T to A, chromosome 10 at 23,941,365 bp
  • C to A, chromosome 10 at 26,981,524 bp
  • C to T, chromosome 11 at 30,834,287 bp
  • T to C, chromosome 12 at 72,902,485 bp
  • G to T, chromosome 12 at 90,729,821 bp
  • T to C, chromosome 12 at 115,952,660 bp
  • A to G, chromosome 13 at 38,191,632 bp
  • A to T, chromosome 13 at 73,607,738 bp
  • C to T, chromosome 13 at 81,494,569 bp
  • C to T, chromosome 14 at 19,891,327 bp
  • T to C, chromosome 14 at 24,158,168 bp
  • G to A, chromosome 14 at 52,312,750 bp
  • A to G, chromosome 15 at 6,491,463 bp
  • T to C, chromosome 15 at 73,695,736 bp
  • T to C, chromosome 15 at 76,596,937 bp
  • A to T, chromosome 16 at 15,663,074 bp
  • A to G, chromosome 16 at 58,456,094 bp
  • A to T, chromosome 17 at 35,013,881 bp
  • A to G, chromosome 17 at 66,413,951 bp
  • T to C, chromosome 18 at 19,971,488 bp
  • T to A, chromosome 18 at 20,682,763 bp
  • T to A, chromosome 18 at 37,308,500 bp
  • T to C, chromosome 18 at 53,714,841 bp
  • T to C, chromosome 18 at 64,553,099 bp
  • T to C, chromosome 19 at 5,029,264 bp
  • T to C, chromosome 19 at 41,943,683 bp
  • A to T, chromosome 19 at 59,022,216 bp
  • C to T, chromosome 19 at 61,175,926 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4615 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041826-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.