Strain Name:
C57BL/6J-MtgxR4635Btlr/Mmmh
Stock Number:
041899-MU
Citation ID:
RRID:MMRRC_041899-MU
Other Names:
R4635 (G1), C57BL/6J-MtgxR4635Btlr
Major Collection:

Gene Information

Scd1
Name: stearoyl-Coenzyme A desaturase 1
Synonyms: stearoyl-CoA desaturase, Scd-1, SCD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20249
VEGA: 19
Homologene: 74538
Tfdp2
Name: transcription factor Dp 2
Synonyms: DP3, DP-3, DP3, A330080J22Rik, 1110029I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 211586
Homologene: 4578
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Kifap3
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16579
Homologene: 7799
Chchd6
Name: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: 1700021B03Rik, 0710001P09Rik, Micos25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66098
Homologene: 11920
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Tox
Name: thymocyte selection-associated high mobility group box
Synonyms: 1700007F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 252838
Homologene: 8822
Mef2a
Name: myocyte enhancer factor 2A
Synonyms: A430079H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17258
HGNC: HGNC:6993
Homologene: 4080
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 193838
Homologene: 19180
Vit
Name: vitrin
Synonyms: 1700110E08Rik, 1700052E02Rik, 2810429K11Rik, AKH, akhirin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Nr1h2
Name: nuclear receptor subfamily 1, group H, member 2
Synonyms: RIP15, LXRbeta, LXRB, Unr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22260
HGNC: HGNC:7965
Homologene: 21397
Rab38
Name: RAB38, member RAS oncogene family
Synonyms: 2310011F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72433
HGNC: HGNC:9776
Homologene: 21353
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Mag
Name: myelin-associated glycoprotein
Synonyms: Gma, siglec-4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17136
HGNC: HGNC:6783
Homologene: 1771
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20271
Homologene: 22738
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74407
Homologene: 12860
Shc2
Name: SHC (Src homology 2 domain containing) transforming protein 2
Synonyms: ShcB, Sli
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216148
Homologene: 19127
Ddx60
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234311
Homologene: 23031
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75718
Homologene: 19431
Tmc3
Name: transmembrane channel-like gene family 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233424
Homologene: 45588
Arhgef26
Name: Rho guanine nucleotide exchange factor (GEF) 26
Synonyms: 8430436L14Rik, 4631416L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 622434
Homologene: 9204
Amer3
Name: APC membrane recruitment 3
Synonyms: Fam123c, 9430069J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 211383
Homologene: 51888
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207777
Homologene: 37961
Abcb1a
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 1A
Synonyms: mdr-3, Mdr1a, P-gp, P-glycoprotein, Pgy-3, Pgy3, multiple drug resistant 1a, MDR3, Pgp, Evi32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Gm960
Name: predicted gene 960
Synonyms: Top6bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381196
VEGA: 19
Homologene: 69381
Olfr993
Name: olfactory receptor 993
Synonyms: GA_x6K02T2Q125-46891524-46890580, MOR203-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258427
Homologene: 79352
Olfr1123
Name: olfactory receptor 1123
Synonyms: GA_x6K02T2Q125-48917235-48918206, MOR264-17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258347
Homologene: 105187
4930548H24Rik
Name: RIKEN cDNA 4930548H24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67656
Hao1
Name: hydroxyacid oxidase 1, liver
Synonyms: GOX, Hao-1, Gox1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15112
HGNC: HGNC:4809
Homologene: 6578
Olfr612
Name: olfactory receptor 612
Synonyms: GA_x6K02T2PBJ9-6251685-6250741, MOR15-3, EG545985
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 545985
Homologene: 79675
Olfr1249
Name: olfactory receptor 1249
Synonyms: GA_x6K02T2Q125-51072323-51071367, MOR231-16P, MOR231-25_p, MOR231-16P, MOR231-17P, Olfr1541-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257984
Gins2
Name: GINS complex subunit 2 (Psf2 homolog)
Synonyms: 2210013I18Rik, 4833427B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 272551
Homologene: 41105
Ferd3l
Name: Fer3 like bHLH transcription factor
Synonyms: fer3, Mnato3, N-twist, Nato3, bHLHa31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 114712
VEGA: 12
Homologene: 14136
Gm13141
Name: predicted gene 13141
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
D10Bwg1379e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 34,587,877 bp
  • C to T, chromosome 1 at 163,814,435 bp
  • T to A, chromosome 2 at 85,414,864 bp
  • T to A, chromosome 2 at 87,418,699 bp
  • A to C, chromosome 2 at 89,630,172 bp
  • T to A, chromosome 2 at 134,523,152 bp
  • A to G, chromosome 3 at 62,340,440 bp
  • A to T, chromosome 4 at 6,990,501 bp
  • T to G, chromosome 4 at 138,610,839 bp
  • GGTTTCTTGATGCCA to G, chromosome 4 at 147,528,104 bp
  • A to T, chromosome 5 at 8,714,927 bp
  • G to A, chromosome 5 at 31,488,091 bp
  • T to C, chromosome 5 at 134,245,174 bp
  • T to C, chromosome 6 at 89,467,466 bp
  • T to C, chromosome 7 at 30,468,007 bp
  • A to G, chromosome 7 at 30,906,923 bp
  • A to C, chromosome 7 at 44,552,537 bp
  • A to G, chromosome 7 at 67,240,427 bp
  • A to G, chromosome 7 at 83,585,082 bp
  • T to C, chromosome 7 at 88,450,646 bp
  • T to C, chromosome 7 at 103,539,148 bp
  • A to G, chromosome 8 at 62,037,067 bp
  • A to G, chromosome 8 at 120,588,976 bp
  • T to A, chromosome 9 at 96,297,674 bp
  • T to C, chromosome 9 at 119,528,985 bp
  • T to C, chromosome 10 at 18,634,855 bp
  • C to T, chromosome 10 at 79,626,286 bp
  • TGCTGCCGCTGCCGC to TGCTGCCGCTGCCGCTGCCGC, chromosome 11 at 69,362,187 bp
  • A to G, chromosome 11 at 87,777,857 bp
  • C to T, chromosome 11 at 100,551,507 bp
  • T to C, chromosome 12 at 33,928,836 bp
  • T to A, chromosome 12 at 71,958,744 bp
  • T to C, chromosome 16 at 32,753,802 bp
  • G to T, chromosome 17 at 24,894,908 bp
  • G to A, chromosome 17 at 78,574,212 bp
  • A to G, chromosome 19 at 4,698,496 bp
  • T to C, chromosome 19 at 44,406,585 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4635 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041899-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.