Strain Detail Sheet
Strain Name:
C57BL/6J-MtgxR4657Btlr/Mmmh
Stock Number:
041917-MU
Citation ID:
RRID:MMRRC_041917-MU
Other Names:
R4657 (G1), C57BL/6J-MtgxR4657Btlr
Major Collection:
Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:894646
NCBI: 110948
Ensembl: ENSMUSG00000040820
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
CCDS: CCDS28346.1
UCSC: Chr16:94129195-94313913
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:109635
NCBI: 22427
Ensembl: ENSMUSG00000031583
VEGA: OTTMUSG00000060957
HGNC: HGNC:12791
Homologene: 6659
CCDS: CCDS22229.1
UCSC: Chr8:33234372-33385542
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gpr83
Name: G protein-coupled receptor 83
Synonyms: RP105, RP82, RP39, glucocorticoid-induced receptor, GIR, Gpr72, Gir
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:95712
NCBI: 14608
Ensembl: ENSMUSG00000031932
VEGA: OTTMUSG00000027389
HGNC: HGNC:4523
Homologene: 7732
CCDS: CCDS22829.1, CCDS80959.1
UCSC: Chr9:14859803-14870789
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, Apoav, 1300007O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:1913363
NCBI: 66113
Ensembl: ENSMUSG00000032079
VEGA: OTTMUSG00000028704
HGNC: HGNC:17288
Homologene: 14197
CCDS: CCDS23143.1
UCSC: Chr9:46268608-46271919
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Spns1
Name: spinster homolog 1
Synonyms: 2210013K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1920908
NCBI: 73658
Ensembl: ENSMUSG00000030741
VEGA: OTTMUSG00000031445
HGNC: HGNC:30621
Homologene: 41530
CCDS: CCDS21826.1
UCSC: Chr7:126370060-126377934
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:104755
NCBI: 16521
Ensembl: ENSMUSG00000032034
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
CCDS: CCDS22952.1
UCSC: Chr9:32314706-32344380
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1917347
NCBI: 70097
Ensembl: ENSMUSG00000015305
VEGA: OTTMUSG00000062029
HGNC: HGNC:19182
Homologene: 69182
CCDS: CCDS23692.1
UCSC: Chr10:8722217-9027745
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Fzr1
Name: fizzy and cell division cycle 20 related 1
Synonyms: Fyr, Cdh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1926790
NCBI: 56371
Ensembl: ENSMUSG00000020235
VEGA: OTTMUSG00000030386
HGNC: HGNC:24824
Homologene: 9444
CCDS: CCDS24057.1
UCSC: Chr10:81366879-81378370
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:95794
NCBI: 14725
Ensembl: ENSMUSG00000027070
VEGA: OTTMUSG00000012988
HGNC: HGNC:6694
Homologene: 20952
CCDS: CCDS38135.1
UCSC: Chr2:69424335-69586067
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tmem248
Name: transmembrane protein 248
Synonyms: G430067H08Rik, A930023A16Rik, 0610007L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1918917
NCBI: 71667
Ensembl: ENSMUSG00000053094
VEGA: OTTMUSG00000055826
HGNC: HGNC:25476
Homologene: 9951
CCDS: CCDS39295.1
UCSC: Chr5:130219744-130243765
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cs
Name: citrate synthase
Synonyms: Cis, 2610511A05Rik, 9030605P22Rik, ahl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:88529
NCBI: 12974
Ensembl: ENSMUSG00000005683
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
CCDS: CCDS24273.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1926048
NCBI: 78798
Ensembl: ENSMUSG00000032624
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
UCSC: Chr17:83350931-83480361
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1923385
NCBI: 109294
Ensembl: ENSMUSG00000048960
VEGA: OTTMUSG00000047927
HGNC: HGNC:22950
Homologene: 23523
CCDS: CCDS48217.1
UCSC: Chr1:10993272-11303683
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1915395
NCBI: 68145
Ensembl: ENSMUSG00000016984
VEGA: OTTMUSG00000005201
HGNC: HGNC:24648
Homologene: 10369
CCDS: CCDS24452.1
UCSC: Chr11:17938749-17953875
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1933162
NCBI: 80877
Ensembl: ENSMUSG00000028080
VEGA: OTTMUSG00000051661
HGNC: HGNC:1742
Homologene: 36205
UCSC: Chr3:86223904-86782694
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1916175
NCBI: 68925
Ensembl: ENSMUSG00000034032
VEGA: OTTMUSG00000016529
HGNC: HGNC:24567
Homologene: 32269
CCDS: CCDS16610.1
UCSC: Chr2:119763959-119787537
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Kat7
Name: K(lysine) acetyltransferase 7
Synonyms: Hbo1, Hboa, Myst2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2182799
NCBI: 217127
Ensembl: ENSMUSG00000038909
VEGA: OTTMUSG00000001619
HGNC: HGNC:17016
Homologene: 5134
UCSC: Chr11:95271853-95310246
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Uhrf1bp1
Name: UHRF1 (ICBP90) binding protein 1
Synonyms: 1110020K19Rik, F830021D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:3041238
NCBI: 224648
Ensembl: ENSMUSG00000039512
VEGA: OTTMUSG00000023192
HGNC: HGNC:21216
Homologene: 9816
CCDS: CCDS37524.1
UCSC: Chr17:27856507-27900040
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ric8b
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8, Ric-8b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:2682307
NCBI: 237422
Ensembl: ENSMUSG00000035620
VEGA: 10
HGNC: HGNC:25555
Homologene: 23080
CCDS: CCDS24084.1, CCDS24085.1
UCSC: Chr10:84917249-85018337
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dkk3
Name: dickkopf WNT signaling pathway inhibitor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1354952
NCBI: 50781
Ensembl: ENSMUSG00000030772
VEGA: OTTMUSG00000060218
HGNC: HGNC:2893
Homologene: 8303
CCDS: CCDS21752.1
UCSC: Chr7:112116019-112159121
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Abcg1
Name: ATP binding cassette subfamily G member 1
Synonyms: White, Abc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:107704
NCBI: 11307
Ensembl: ENSMUSG00000024030
VEGA: OTTMUSG00000025573
HGNC: HGNC:73
Homologene: 21022
CCDS: CCDS28602.1
UCSC: Chr17:31057694-31117984
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Trim27
Name: tripartite motif-containing 27
Synonyms: Rfp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:97904
NCBI: 19720
Ensembl: ENSMUSG00000021326
VEGA: OTTMUSG00000032925
HGNC: HGNC:9975
Homologene: 111010
CCDS: CCDS36607.1
UCSC: Chr13:21179450-21194723
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Polr3f
Name: polymerase (RNA) III (DNA directed) polypeptide F
Synonyms: 3110032A07Rik, 2810411G20Rik, RPC39, RPC6, 3010019O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1924086
NCBI: 70408
Ensembl: ENSMUSG00000027427
VEGA: OTTMUSG00000004234
HGNC: HGNC:15763
Homologene: 4722
CCDS: CCDS16820.1
UCSC: Chr2:144527745-144541779
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Snrpb2
Name: U2 small nuclear ribonucleoprotein B
Synonyms: 2810052G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:104805
NCBI: 20639
Ensembl: ENSMUSG00000008333
VEGA: OTTMUSG00000015607
HGNC: HGNC:11155
Homologene: 37728
CCDS: CCDS16808.1
UCSC: Chr2:143063069-143072052
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: 2610036I19Rik, 2610510L13Rik, Acinus
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1891824
NCBI: 56215
Ensembl: ENSMUSG00000022185
VEGA: OTTMUSG00000033084
HGNC: HGNC:17066
Homologene: 22853
UCSC: Chr14:54642161-54686931
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:107735
NCBI: 270163
Ensembl: ENSMUSG00000039585
VEGA: OTTMUSG00000034123
HGNC: HGNC:7608
Homologene: 21371
CCDS: CCDS52820.1
UCSC: Chr9:59750843-59928866
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:2444804
NCBI: 665775
Ensembl: ENSMUSG00000061755
VEGA: OTTMUSG00000055781
HGNC: HGNC:31792
Homologene: 45109
CCDS: CCDS39079.1, CCDS80273.1
UCSC: Chr5:41787538-41844362
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2448530
NCBI: 230895
Ensembl: ENSMUSG00000020220
VEGA: OTTMUSG00000010745
HGNC: HGNC:23595
Homologene: 15583
CCDS: CCDS51369.1, CCDS71517.1
UCSC: Chr4:144904717-145195370
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ralbp1
Name: ralA binding protein 1
Synonyms: Rip1, RLIP76
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:108466
NCBI: 19765
Ensembl: ENSMUSG00000024096
VEGA: 17
HGNC: HGNC:9841
Homologene: 4940
CCDS: CCDS37678.1
UCSC: Chr17:65848415-65885755
Genome Browser [Click image to go to Jbrowse]
Additional Resources
D16Ertd472e
Name: DNA segment, Chr 16, ERATO Doi 472, expressed
Synonyms: 2310009O17Rik, E330003K22Rik, 1700010I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:1196400
NCBI: 67102
Ensembl: ENSMUSG00000022864
VEGA: OTTMUSG00000019868
HGNC: HGNC:16459
Homologene: 9696
CCDS: CCDS28278.1
UCSC: Chr16:78540336-78576688
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:1338049
NCBI: 20403
Ensembl: ENSMUSG00000020640
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
CCDS: CCDS36398.1
UCSC: Chr12:4592467-4713952
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1346098
NCBI: 24116
Ensembl: ENSMUSG00000029111
VEGA: OTTMUSG00000025105
HGNC: HGNC:12768
Homologene: 68478
CCDS: CCDS19208.1
UCSC: Chr5:33898179-33936258
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Srsf6
Name: serine and arginine-rich splicing factor 6
Synonyms: 1210001E11Rik, Sfrs6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1915246
NCBI: 67996
Ensembl: ENSMUSG00000016921
VEGA: OTTMUSG00000001060
HGNC: HGNC:10788
Homologene: 110783
CCDS: CCDS17002.1
UCSC: Chr2:162931508-162937121
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pwwp3a
Name: PWWP domain containing 3A, DNA repair factor
Synonyms: 9430059D04Rik, Mum1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1915364
NCBI: 68114
Ensembl: ENSMUSG00000020156
VEGA: OTTMUSG00000000010
HGNC: HGNC:29641
Homologene: 11349
CCDS: CCDS24014.1
UCSC: Chr10:80226434-80245144
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Arhgap44
Name: Rho GTPase activating protein 44
Synonyms: AU040829
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2144423
NCBI: 216831
Ensembl: ENSMUSG00000033389
VEGA: OTTMUSG00000005898
HGNC: HGNC:29096
Homologene: 65284
CCDS: CCDS36180.1
UCSC: Chr11:65002039-65163124
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Rfx7
Name: regulatory factor X, 7
Synonyms: 2510005N23Rik, 9930116O05Rik, D130086K05Rik, Rfxdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:2442675
NCBI: 319758
Ensembl: ENSMUSG00000037674
VEGA: OTTMUSG00000044716
HGNC: HGNC:25777
Homologene: 11275
CCDS: CCDS40686.1
UCSC: Chr9:72532168-72622949
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Eda2r
Name: ectodysplasin A2 receptor
Synonyms: 9430060M22Rik, Xedar
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
MGI: MGI:2442860
NCBI: 245527
Ensembl: ENSMUSG00000034457
VEGA: OTTMUSG00000018046
HGNC: HGNC:17756
Homologene: 11033
CCDS: CCDS30293.1
UCSC: ChrX:97333837-97377218
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:3033336
NCBI: 230676
Ensembl: ENSMUSG00000033253
VEGA: OTTMUSG00000008774
HGNC: HGNC:29040
Homologene: 49413
CCDS: CCDS51283.1
UCSC: Chr4:118362740-118409271
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nr4a3
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: TEC, NOR-1, Nor1, MINOR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1352457
NCBI: 18124
Ensembl: ENSMUSG00000028341
VEGA: OTTMUSG00000006813
HGNC: HGNC:7982
Homologene: 5074
CCDS: CCDS18163.1
UCSC: Chr4:48044889-48086447
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gp2
Name: glycoprotein 2 (zymogen granule membrane)
Synonyms: 2310037I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1914383
NCBI: 67133
Ensembl: ENSMUSG00000030954
VEGA: OTTMUSG00000059101
HGNC: HGNC:4441
Homologene: 133790
CCDS: CCDS21779.1
UCSC: Chr7:119442542-119459272
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2685047
NCBI: 545370
Ensembl: ENSMUSG00000066842
VEGA: OTTMUSG00000021664
HGNC: HGNC:19194
Homologene: 23741
CCDS: CCDS15357.2
UCSC: Chr1:150562500-150993777
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:3643515
NCBI: 667772
Ensembl: ENSMUSG00000092009
VEGA: 16
HGNC: HGNC:31073
Homologene: 18929
CCDS: CCDS49868.1
UCSC: Chr16:49057486-49199563
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2155808
NCBI: 241035
Ensembl: ENSMUSG00000043760
VEGA: OTTMUSG00000026248
HGNC: HGNC:9016
Homologene: 16336
CCDS: CCDS14841.1
UCSC: Chr1:20057779-20618082
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1203Clo, b2b1279Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:1100864
NCBI: 13411
Ensembl: ENSMUSG00000018581
VEGA: OTTMUSG00000040132
HGNC: HGNC:2942
Homologene: 2801
CCDS: CCDS36578.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:2183153
NCBI: 192190
Ensembl: ENSMUSG00000038725
VEGA: OTTMUSG00000060491
HGNC: HGNC:20313
Homologene: 16332
CCDS: CCDS84169.1
UCSC: Chr15:44457372-44601376
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: Rev-1, Rec-1, Atrc-1, Atrc1, 4831426K01Rik, mCAT-1, Cat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:88117
NCBI: 11987
Ensembl: ENSMUSG00000041313
VEGA: OTTMUSG00000025707
HGNC: HGNC:11057
Homologene: 20658
CCDS: CCDS19882.1
UCSC: Chr5:148327410-148399904
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cdh16
Name: cadherin 16
Synonyms: KSP-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:106671
NCBI: 12556
Ensembl: ENSMUSG00000031881
VEGA: OTTMUSG00000061956
HGNC: HGNC:1755
Homologene: 2997
UCSC: Chr8:104601915-104624396
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:1274784
NCBI: 110789
Ensembl: ENSMUSG00000069170
VEGA: OTTMUSG00000032905
HGNC: HGNC:17416
Homologene: 19815
CCDS: CCDS36737.1
UCSC: Chr13:81095068-81633388
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:2152200
NCBI: 117147
Ensembl: ENSMUSG00000033533
VEGA: OTTMUSG00000023676
HGNC: HGNC:18049
Homologene: 24930
CCDS: CCDS21783.1
UCSC: Chr7:119617763-119662515
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:3035141
NCBI: 242259
Ensembl: ENSMUSG00000028360
VEGA: OTTMUSG00000030388
HGNC: HGNC:28524
Homologene: 72094
CCDS: CCDS38679.1
UCSC: Chr3:153973419-154271747
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2681862
NCBI: 380698
Ensembl: ENSMUSG00000061462
VEGA: OTTMUSG00000005776
HGNC: HGNC:15719
Homologene: 70869
UCSC: Chr11:58994256-59136375
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Arhgef38
Name: Rho guanine nucleotide exchange factor (GEF) 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1924919
NCBI: 77669
Ensembl: ENSMUSG00000040969
VEGA: OTTMUSG00000030538
HGNC: HGNC:25968
Homologene: 137396
CCDS: CCDS17849.1
UCSC: Chr3:133159529-133234889
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ccdc148
Name: coiled-coil domain containing 148
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3039583
NCBI: 227933
Ensembl: ENSMUSG00000036641
VEGA: OTTMUSG00000012754
HGNC: HGNC:25191
Homologene: 16353
CCDS: CCDS50587.1
UCSC: Chr2:58821697-59160660
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2444274
NCBI: 241116
Ensembl: ENSMUSG00000047021
VEGA: OTTMUSG00000026700
HGNC: HGNC:25325
Homologene: 28093
CCDS: CCDS15060.1
UCSC: Chr1:74902071-74935628
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAG1, IGFBP-4ase, PAPP-A, 8430414N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:97479
NCBI: 18491
Ensembl: ENSMUSG00000028370
VEGA: OTTMUSG00000000318
HGNC: HGNC:8602
Homologene: 31097
CCDS: CCDS18267.1
UCSC: Chr4:65124174-65357512
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:2448580
NCBI: 329421
Ensembl: ENSMUSG00000042064
VEGA: OTTMUSG00000013112
HGNC: HGNC:15576
Homologene: 51393
CCDS: CCDS38139.1
UCSC: Chr2:70039126-70429195
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Shroom1
Name: shroom family member 1
Synonyms: 1300007L22Rik, Shrm1, Apx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1919024
NCBI: 71774
Ensembl: ENSMUSG00000018387
VEGA: OTTMUSG00000005639
HGNC: HGNC:24084
Homologene: 12411
CCDS: CCDS24680.2, CCDS70182.1
UCSC: Chr11:53456707-53467766
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1913107
NCBI: 107527
Ensembl: ENSMUSG00000070942
VEGA: OTTMUSG00000050520
HGNC: HGNC:5999
Homologene: 2860
CCDS: CCDS14910.1
UCSC: Chr1:40324438-40367555
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr347
Name: olfactory receptor 347
Synonyms: GA_x6K02T2NLDC-33428755-33429693, MOR136-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3030181
NCBI: 258945
Ensembl: ENSMUSG00000111863
VEGA: OTTMUSG00000012209
Homologene: 51790
CCDS: CCDS15979.1
UCSC: Chr2:36734323-36735261
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1197518
NCBI: 11302
Ensembl: ENSMUSG00000025375
VEGA: OTTMUSG00000004053
HGNC: HGNC:21
Homologene: 74861
CCDS: CCDS25725.1, CCDS56826.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp811
Name: zinc finger protein 811
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:2682944
NCBI: 240063
Ensembl: ENSMUSG00000055202
VEGA: OTTMUSG00000056163
CCDS: CCDS79528.1
UCSC: Chr17:32795676-32810105
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:2658851
NCBI: 218165
Ensembl: ENSMUSG00000047094
VEGA: 13
HGNC: HGNC:21017
Homologene: 125376
CCDS: CCDS49241.1
UCSC: Chr13:40001882-40288011
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2442895
NCBI: 237711
Ensembl: ENSMUSG00000044072
VEGA: OTTMUSG00000005340
HGNC: HGNC:35412
Homologene: 104282
CCDS: CCDS24504.2
UCSC: Chr11:29743044-30026042
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1314882
NCBI: 15259
Ensembl: ENSMUSG00000027177
VEGA: OTTMUSG00000014944
HGNC: HGNC:4915
Homologene: 55923
CCDS: CCDS16489.1
UCSC: Chr2:104426481-104494489
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm5828
Name: predicted gene 5828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:3644176
NCBI: 545306
Ensembl: ENSMUSG00000091020
VEGA: OTTMUSG00000048082
UCSC: Chr1:16768279-16770138
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr873
Name: olfactory receptor 873
Synonyms: GA_x6K02T2PVTD-14040245-14041204, MOR145-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:3030707
NCBI: 258554
Ensembl: ENSMUSG00000049028
VEGA: OTTMUSG00000061732
HGNC: HGNC:8396
Homologene: 115528
CCDS: CCDS22876.1
UCSC: Chr9:20300211-20301170
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1333883
NCBI: 16798
Ensembl: ENSMUSG00000040021
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
CCDS: CCDS48494.1
UCSC: Chr10:7681209-7716461
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pcdhb14
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:2136749
NCBI: 93885
Ensembl: ENSMUSG00000044043
VEGA: OTTMUSG00000050740
Homologene: 70876
CCDS: CCDS29180.1
UCSC: Chr18:37447657-37451094
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Jkamp
Name: JNK1/MAPK8-associated membrane protein
Synonyms: 1200003C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:1915057
NCBI: 104771
Ensembl: ENSMUSG00000005078
VEGA: OTTMUSG00000027642
HGNC: HGNC:20184
Homologene: 9524
CCDS: CCDS25967.1, CCDS56844.1
UCSC: Chr12:72085839-72101527
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Stk25
Name: serine/threonine kinase 25 (yeast)
Synonyms: Ste20-like, Ysk1, 1500019J11Rik, SOK-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1891699
NCBI: 59041
Ensembl: ENSMUSG00000026277
VEGA: OTTMUSG00000026452
HGNC: HGNC:11404
Homologene: 48428
CCDS: CCDS15192.1
UCSC: Chr1:93620751-93654216
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cpne7
Name: copine VII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2142747
NCBI: 102278
Ensembl: ENSMUSG00000034796
VEGA: OTTMUSG00000027555
HGNC: HGNC:2320
Homologene: 65128
CCDS: CCDS22748.1
UCSC: Chr8:123117313-123135185
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2140201
NCBI: 230612
Ensembl: ENSMUSG00000028544
VEGA: OTTMUSG00000009474
HGNC: HGNC:22146
Homologene: 17081
CCDS: CCDS18474.1
UCSC: Chr4:111875374-111902796
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mterf1b
Name: mitochondrial transcription termination factor 1b
Synonyms: Gm9897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:3704243
NCBI: 208595
Ensembl: ENSMUSG00000053178
VEGA: OTTMUSG00000042135
HGNC: HGNC:21463
Homologene: 5073
CCDS: CCDS39004.2
UCSC: Chr5:4192367-4197651
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Wdr86
Name: WD repeat domain 86
Synonyms: 2810046M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1915466
NCBI: 269633
Ensembl: ENSMUSG00000055235
VEGA: OTTMUSG00000023533
HGNC: HGNC:28020
Homologene: 90112
CCDS: CCDS39031.1
UCSC: Chr5:24699519-24730948
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tspan10
Name: tetraspanin 10
Synonyms: Ocsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2384781
NCBI: 208634
Ensembl: ENSMUSG00000039691
VEGA: OTTMUSG00000004175
HGNC: HGNC:29942
Homologene: 49972
CCDS: CCDS25733.2
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: IAP, Akp-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:87984
NCBI: 11648
Ensembl: ENSMUSG00000036500
VEGA: OTTMUSG00000048155
HGNC: HGNC:441|HGNC:437
Homologene: 134333
CCDS: CCDS15127.1
UCSC: Chr1:87125008-87127912
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gucd1
Name: guanylyl cyclase domain containing 1
Synonyms: 1110038D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:1916028
NCBI: 68778
Ensembl: ENSMUSG00000033416
VEGA: OTTMUSG00000031798
HGNC: HGNC:14237
Homologene: 57149
CCDS: CCDS35936.1, CCDS83713.1
UCSC: Chr10:75506814-75517967
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Oxct2b
Name: 3-oxoacid CoA transferase 2B
Synonyms: Scot-t2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2664115
NCBI: 353371
Ensembl: ENSMUSG00000076438
VEGA: OTTMUSG00000008932
Homologene: 137359
CCDS: CCDS18609.1
UCSC: Chr4:123116248-123118000
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2444594
NCBI: 320718
Ensembl: ENSMUSG00000042268
VEGA: OTTMUSG00000021566
HGNC: HGNC:14469
Homologene: 14179
CCDS: CCDS15273.1
UCSC: Chr1:131744022-131771504
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Haao
Name: 3-hydroxyanthranilate 3,4-dioxygenase
Synonyms: 0610007K21Rik, 0610012J07Rik, 3-HAO, 3HAO, 3-HAOxase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1349444
NCBI: 107766
Ensembl: ENSMUSG00000000673
VEGA: 17
HGNC: HGNC:4796
Homologene: 8148
CCDS: CCDS37709.1
UCSC: Chr17:83831348-83847958
Genome Browser [Click image to go to Jbrowse]
Additional Resources
H2-Q7
Name: histocompatibility 2, Q region locus 7
Synonyms: H-2Q7, Qa-7, Qa7, Ped
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:95936
NCBI: 15018
Ensembl: ENSMUSG00000060550
VEGA: OTTMUSG00000037191
HGNC: HGNC:4931
Homologene: 128352
UCSC: Chr17:35439147-35443773
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pcsk1
Name: proprotein convertase subtilisin/kexin type 1
Synonyms: PC3, prohormone convertase 1/3, Nec-1, Nec1, PC1, SPC3, Phpp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:97511
NCBI: 18548
Ensembl: ENSMUSG00000021587
VEGA: OTTMUSG00000026053
HGNC: HGNC:8743
Homologene: 379
CCDS: CCDS26649.1
UCSC: Chr13:75089420-75134861
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Amy2b
Name: amylase 2b
Synonyms: Amy-X, mAmy2-1, Amy2-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:104547
NCBI: 545562
Ensembl: ENSMUSG00000083079
VEGA: OTTMUSG00000022462
UCSC: Chr3:113147656-113156727
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ifi204
Name: interferon activated gene 204
Synonyms: p204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:96429
NCBI: 15951
Ensembl: ENSMUSG00000073489
VEGA: OTTMUSG00000033920
HGNC: HGNC:5395
Homologene: 115929
CCDS: CCDS35792.1
UCSC: Chr1:173747293-173767069
Genome Browser [Click image to go to Jbrowse]
Additional Resources
AI429214
Name: expressed sequence AI429214
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2142538
NCBI: 621080
Ensembl: ENSMUSG00000074384
VEGA: OTTMUSG00000061068
HGNC: HGNC:26345
Homologene: 82747
CCDS: CCDS22250.1
UCSC: Chr8:36993575-36995533
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ccin
Name: calicin
Synonyms: 4933417A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:3045316
NCBI: 442829
Ensembl: ENSMUSG00000070999
VEGA: OTTMUSG00000007205
HGNC: HGNC:1568
Homologene: 4306
CCDS: CCDS18118.1
UCSC: Chr4:43983504-43985533
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lpo
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1923363
NCBI: 76113
Ensembl: ENSMUSG00000009356
VEGA: OTTMUSG00000001439
HGNC: HGNC:6678
Homologene: 21240
CCDS: CCDS25218.1
UCSC: Chr11:87806428-87826119
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ptgir
Name: prostaglandin I receptor (IP)
Synonyms: prostacyclin receptor, IP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:99535
NCBI: 19222
Ensembl: ENSMUSG00000043017
VEGA: OTTMUSG00000033384
HGNC: HGNC:9602
Homologene: 7496
CCDS: CCDS20857.2
UCSC: Chr7:16905419-16910905
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Il36a
Name: interleukin 36A
Synonyms: IL-1H1, Fil1, Fil1epsilon, Il1f6, If36a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1859324
NCBI: 54448
Ensembl: ENSMUSG00000026984
VEGA: OTTMUSG00000011962
HGNC: HGNC:15562
Homologene: 8688
CCDS: CCDS15734.1
UCSC: Chr2:24215417-24225701
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: dectin-2, Clecsf10, Nkcl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:1861231
NCBI: 56620
Ensembl: ENSMUSG00000023349
VEGA: OTTMUSG00000027044
HGNC: HGNC:14556
Homologene: 84615
UCSC: Chr6:123229843-123247024
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ifi211
Name: interferon activated gene 211
Synonyms: Mnda, Ifi205b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:3041120
NCBI: 381308
Ensembl: ENSMUSG00000026536
VEGA: OTTMUSG00000050203
HGNC: HGNC:5395
Homologene: 115929
CCDS: CCDS15532.1
UCSC: Chr1:173896339-173914047
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cav2
Name: caveolin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:107571
NCBI: 12390
Ensembl: ENSMUSG00000000058
VEGA: OTTMUSG00000024026
HGNC: HGNC:1528
Homologene: 942
CCDS: CCDS19923.1, CCDS71727.1
UCSC: Chr6:17281185-17289130
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cd8b1
Name: CD8 antigen, beta chain 1
Synonyms: Ly-C, Ly-3, Lyt-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:88347
NCBI: 12526
Ensembl: ENSMUSG00000053044
VEGA: OTTMUSG00000057911
HGNC: HGNC:1707
Homologene: 3621
CCDS: CCDS39506.1
UCSC: Chr6:71322812-71337451
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tcp10b
Name: t-complex protein 10b
Synonyms: T66B-a, D17Leh66ba, D17Leh66B, Tcp-10b, Tcp-10bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:98542
NCBI: 21462
Ensembl: ENSMUSG00000055602
VEGA: OTTMUSG00000037013
Homologene: 83254
CCDS: CCDS28401.1
UCSC: Chr17:13061109-13082226
Genome Browser [Click image to go to Jbrowse]
Additional Resources
H2bu2
Name: H2B.U histone 2
Synonyms: 1500011O09Rik, Hist3h2ba
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1925553
NCBI: 78303
Ensembl: ENSMUSG00000056895
VEGA: OTTMUSG00000005770
HGNC: HGNC:4747|HGNC:20515
Homologene: 134740
CCDS: CCDS24754.1
UCSC: Chr11:58948911-58949372
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Wfdc18
Name: WAP four-disulfide core domain 18
Synonyms: WDNM1, Kal1, Expi
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:107506
NCBI: 14038
Ensembl: ENSMUSG00000000983
VEGA: OTTMUSG00000000970
CCDS: CCDS25175.1
UCSC: Chr11:83709004-83711360
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dcaf15
Name: DDB1 and CUL4 associated factor 15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2684420
NCBI: 212123
Ensembl: ENSMUSG00000037103
VEGA: OTTMUSG00000061197
HGNC: HGNC:25095
Homologene: 18182
CCDS: CCDS40406.1
UCSC: Chr8:84097072-84104792
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cyp2ab1
Name: cytochrome P450, family 2, subfamily ab, polypeptide 1
Synonyms: EG224044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:3644957
NCBI: 224044
Ensembl: ENSMUSG00000022818
VEGA: OTTMUSG00000043179
HGNC: HGNC:39975
Homologene: 120487
CCDS: CCDS49791.1
UCSC: Chr16:20308387-20325404
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Krtap5-4
Name: keratin associated protein 5-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1354758
NCBI: 50775
Ensembl: ENSMUSG00000045236
VEGA: OTTMUSG00000060152
CCDS: CCDS22027.1
UCSC: Chr7:142303502-142304503
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ppp2r3d
Name: protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta
Synonyms: PR59, Ppp2r3, Ppp2r3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:1335093
Ensembl: ENSMUSG00000093803
VEGA: OTTMUSG00000046326
Gm14149
Name: predicted gene 14149
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3651549
NCBI: 100038513
Ensembl: ENSMUSG00000067352
VEGA: OTTMUSG00000015804
UCSC: Chr2:151205195-151231614
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm13889
Name: predicted gene 13889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3652053
NCBI: 620695
Ensembl: ENSMUSG00000087006
VEGA: OTTMUSG00000014994
HGNC: HGNC:38675
Homologene: 83963
CCDS: CCDS79830.1
UCSC: Chr2:93955810-93957100
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm5866
Name: predicted gene 5866
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:3645339
NCBI: 545750
Ensembl: ENSMUSG00000095078
VEGA: OTTMUSG00000054576
UCSC: Chr5:52582031-52583086
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ighv5-12-4
Name: immunoglobulin heavy variable 5-12-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:3645977
NCBI: 628098
Ensembl: ENSMUSG00000103033
VEGA: OTTMUSG00000051706
Genome Browser [Click image to go to Jbrowse]
Additional Resources
RP23-243M12.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Gm15518
Name: predicted gene 15518
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:3801752
NCBI: 102633939
Ensembl: ENSMUSG00000087066
VEGA: OTTMUSG00000023120
UCSC: Chr16:49759703-49775922
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
- T to A, chromosome 1 at 11,065,825 bp
- T to A, chromosome 1 at 16,769,418 bp
- T to A, chromosome 1 at 20,364,167 bp
- CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp
- T to A, chromosome 1 at 74,925,354 bp
- A to G, chromosome 1 at 87,125,834 bp
- A to T, chromosome 1 at 93,625,656 bp
- T to C, chromosome 1 at 131,753,138 bp
- A to G, chromosome 1 at 150,624,550 bp
- C to A, chromosome 1 at 173,760,361 bp
- A to G, chromosome 1 at 173,907,660 bp
- T to A, chromosome 2 at 24,224,404 bp
- T to A, chromosome 2 at 36,734,403 bp
- G to T, chromosome 2 at 59,001,888 bp
- C to A, chromosome 2 at 69,466,993 bp
- T to C, chromosome 2 at 70,238,899 bp
- G to T, chromosome 2 at 93,956,576 bp
- C to T, chromosome 2 at 104,433,759 bp
- C to T, chromosome 2 at 119,775,006 bp
- A to G, chromosome 2 at 143,070,973 bp
- A to T, chromosome 2 at 144,536,336 bp
- A to T, chromosome 2 at 151,230,764 bp
- T to A, chromosome 2 at 162,933,427 bp
- T to G, chromosome 3 at 86,737,164 bp
- C to T, chromosome 3 at 113,153,477 bp
- C to A, chromosome 3 at 133,234,681 bp
- A to G, chromosome 3 at 154,256,584 bp
- A to T, chromosome 4 at 43,984,981 bp
- A to T, chromosome 4 at 48,051,522 bp
- G to A, chromosome 4 at 65,314,796 bp
- C to A, chromosome 4 at 111,891,744 bp
- A to T, chromosome 4 at 118,397,669 bp
- T to C, chromosome 4 at 123,117,133 bp
- A to G, chromosome 4 at 145,074,842 bp
- T to A, chromosome 5 at 4,197,176 bp
- A to T, chromosome 5 at 24,718,231 bp
- T to G, chromosome 5 at 33,901,813 bp
- G to T, chromosome 5 at 41,818,612 bp
- G to A, chromosome 5 at 52,582,920 bp
- T to A, chromosome 5 at 130,231,774 bp
- T to A, chromosome 5 at 148,352,399 bp
- A to T, chromosome 6 at 17,281,410 bp
- C to T, chromosome 6 at 71,329,774 bp
- T to C, chromosome 6 at 123,232,196 bp
- A to G, chromosome 7 at 16,907,146 bp
- T to C, chromosome 7 at 112,149,046 bp
- T to C, chromosome 7 at 119,457,168 bp
- T to A, chromosome 7 at 119,640,694 bp
- G to T, chromosome 7 at 126,374,302 bp
- T to A, chromosome 7 at 142,303,754 bp
- A to T, chromosome 8 at 33,335,991 bp
- T to A, chromosome 8 at 36,994,391 bp
- A to C, chromosome 8 at 84,102,838 bp
- T to A, chromosome 8 at 104,615,226 bp
- T to A, chromosome 8 at 123,134,575 bp
- G to A, chromosome 9 at 14,866,983 bp
- A to C, chromosome 9 at 20,300,623 bp
- A to G, chromosome 9 at 32,322,677 bp
- A to G, chromosome 9 at 46,269,872 bp
- T to C, chromosome 9 at 59,875,416 bp
- T to C, chromosome 9 at 72,611,692 bp
- A to G, chromosome 9 at 124,476,821 bp
- T to A, chromosome 10 at 7,705,684 bp
- T to C, chromosome 10 at 8,725,660 bp
- T to C, chromosome 10 at 75,511,125 bp
- T to A, chromosome 10 at 80,233,014 bp
- T to A, chromosome 10 at 81,367,552 bp
- T to C, chromosome 10 at 84,992,137 bp
- A to G, chromosome 10 at 128,353,137 bp
- A to T, chromosome 11 at 17,946,964 bp
- A to T, chromosome 11 at 29,805,108 bp
- T to C, chromosome 11 at 53,465,588 bp
- C to T, chromosome 11 at 58,948,971 bp
- T to A, chromosome 11 at 59,042,290 bp
- A to G, chromosome 11 at 65,005,452 bp
- C to A, chromosome 11 at 83,709,869 bp
- T to C, chromosome 11 at 87,814,347 bp
- C to A, chromosome 11 at 95,277,598 bp
- A to T, chromosome 11 at 120,013,478 bp
- A to G, chromosome 11 at 120,444,498 bp
- A to G, chromosome 12 at 4,713,197 bp
- G to T, chromosome 12 at 72,094,049 bp
- A to T, chromosome 12 at 113,762,267 bp
- A to T, chromosome 12 at 118,192,427 bp
- T to C, chromosome 13 at 21,183,760 bp
- G to A, chromosome 13 at 40,015,388 bp
- T to A, chromosome 13 at 75,132,235 bp
- C to T, chromosome 13 at 81,405,364 bp
- C to T, chromosome 14 at 50,950,871 bp
- A to G, chromosome 14 at 54,643,047 bp
- G to A, chromosome 15 at 44,547,347 bp
- A to T, chromosome 16 at 20,313,072 bp
- A to T, chromosome 16 at 49,172,058 bp
- A to G, chromosome 16 at 49,762,594 bp
- A to T, chromosome 16 at 78,547,926 bp
- A to G, chromosome 16 at 94,262,698 bp
- T to A, chromosome 17 at 13,073,617 bp
- T to A, chromosome 17 at 27,890,105 bp
- T to A, chromosome 17 at 31,108,434 bp
- C to A, chromosome 17 at 32,800,923 bp
- T to A, chromosome 17 at 35,442,759 bp
- T to C, chromosome 17 at 65,852,691 bp
- A to T, chromosome 17 at 83,450,948 bp
- A to T, chromosome 17 at 83,832,345 bp
- A to G, chromosome 18 at 37,448,847 bp
- T to A, chromosome X at 97,341,633 bp
Genotype Determination
- Genotyping Protocol(s)
- Center protocol and contact for technical support will be shipped with mice.
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4657 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Colony Surveillance Program and Current Health Reports
Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
The donor or their institution limits the distribution to non-profit institutions only.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
Click button to Request this one strain. (Use the
MMRRC Catalog Search to request more than one strain.)
| MMRRC Item # | Description | Distribution Fee / Unit (US $) *Shipping & Handling not included* |
Units | Notes |
|---|---|---|---|---|
| 041917-MU-RESUS | Litter recovered from cryo-archive | $5,475.00 / Non-Profit | Litter | Recovered litter4; additional fees for any special requests. |
| Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information. | ||||
Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the
Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.