Strain Name:
C57BL/6J-MtgxR4657Btlr/Mmmh
Stock Number:
041917-MU
Citation ID:
RRID:MMRRC_041917-MU
Other Names:
R4657 (G1), C57BL/6J-MtgxR4657Btlr
Major Collection:

Gene Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: D16Jhu34, 410I21.SP6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 22427
Homologene: 6659
Gpr83
Name: G protein-coupled receptor 83
Synonyms: Gir, RP105, RP39, RP82, Gpr72, glucocorticoid-induced receptor, GIR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 14608
HGNC: HGNC:4523
Homologene: 7732
Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, Apoav, 1300007O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 66113
Homologene: 14197
Spns1
Name: spinster homolog 1
Synonyms: 2210013K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 73658
Homologene: 41530
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: GIRK4, Kir3.4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70097
Homologene: 69182
Fzr1
Name: fizzy and cell division cycle 20 related 1
Synonyms: Cdh1, Fyr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 56371
Homologene: 9444
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: D230004K18Rik, b2b1625.2Clo, Gp330, Megalin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Tmem248
Name: transmembrane protein 248
Synonyms: G430067H08Rik, 0610007L01Rik, A930023A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 71667
Homologene: 9951
Cs
Name: citrate synthase
Synonyms: 2610511A05Rik, ahl4, 9030605P22Rik, Cis
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 12974
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: Depdc2, 6230420N16Rik, C030045D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 109294
Homologene: 23523
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68145
Homologene: 10369
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: D3Ertd775e, Lba
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: A730023M06Rik, 1190005L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 68925
Homologene: 32269
Kat7
Name: K(lysine) acetyltransferase 7
Synonyms: Hbo1, Hboa, Myst2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217127
Homologene: 5134
Uhrf1bp1
Name: UHRF1 (ICBP90) binding protein 1
Synonyms: F830021D11Rik, 1110020K19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224648
Homologene: 9816
Ric8b
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8b, Ric-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237422
VEGA: 10
Homologene: 23080
Dkk3
Name: dickkopf WNT signaling pathway inhibitor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 50781
HGNC: HGNC:2893
Homologene: 8303
Abcg1
Name: ATP binding cassette subfamily G member 1
Synonyms: Abc8, White
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 11307
HGNC: HGNC:73
Homologene: 21022
Trim27
Name: tripartite motif-containing 27
Synonyms: Rfp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 19720
HGNC: HGNC:9975
Homologene: 111010
Polr3f
Name: polymerase (RNA) III (DNA directed) polypeptide F
Synonyms: RPC6, RPC39, 3110032A07Rik, 2810411G20Rik, 3010019O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 70408
Homologene: 4722
Snrpb2
Name: U2 small nuclear ribonucleoprotein B
Synonyms: 2810052G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20639
Homologene: 37728
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: Acinus, 2610036I19Rik, 2610510L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 56215
Homologene: 22853
Myo9a
Name: myosin IXa
Synonyms: C130068I12Rik, 4732465J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 665775
Homologene: 45109
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230895
Homologene: 15583
Ralbp1
Name: ralA binding protein 1
Synonyms: RLIP76, Rip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 19765
VEGA: 17
HGNC: HGNC:9841
Homologene: 4940
D16Ertd472e
Name: DNA segment, Chr 16, ERATO Doi 472, expressed
Synonyms: 2310009O17Rik, E330003K22Rik, 1700010I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 67102
Homologene: 9696
Itsn2
Name: intersectin 2
Synonyms: Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B, Sh3p18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Nelf-A, Whsc2, Whsc2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 24116
Homologene: 68478
Srsf6
Name: serine/arginine-rich splicing factor 6
Synonyms: 1210001E11Rik, Sfrs6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 67996
Homologene: 110783
Pwwp3a
Name: PWWP domain containing 3A, DNA repair factor
Synonyms: 9430059D04Rik, Mum1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 68114
Homologene: 11349
Arhgap44
Name: Rho GTPase activating protein 44
Synonyms: AU040829
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216831
Homologene: 65284
Rfx7
Name: regulatory factor X, 7
Synonyms: D130086K05Rik, 2510005N23Rik, Rfxdc2, 9930116O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 319758
Homologene: 11275
Eda2r
Name: ectodysplasin A2 receptor
Synonyms: Xedar, 9430060M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Chemically Induced
NCBI: 245527
Homologene: 11033
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230676
Homologene: 49413
Nr4a3
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: Nor1, MINOR, NOR-1, TEC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18124
HGNC: HGNC:7982
Homologene: 5074
Gp2
Name: glycoprotein 2 (zymogen granule membrane)
Synonyms: 2310037I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67133
HGNC: HGNC:4441
Homologene: 133790
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545370
Homologene: 23741
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 667772
VEGA: 16
Homologene: 18929
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: FPC, tigmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: b2b1289Clo, b2b1727Clo, b2b598Clo, lrd, b2b1203Clo, b2b1279Clo, avc4, Dnahc11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: PKHDL1, fibrocystin L, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 192190
Homologene: 16332
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: Rev-1, Rec-1, Cat1, 4831426K01Rik, Atrc1, mCAT-1, Atrc-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 11987
Homologene: 20658
Cdh16
Name: cadherin 16
Synonyms: KSP-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 12556
HGNC: HGNC:1755
Homologene: 2997
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mgr1, Mass1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 110789
Homologene: 19815
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 117147
Homologene: 24930
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 242259
Homologene: 72094
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 380698
Homologene: 70869
Arhgef38
Name: Rho guanine nucleotide exchange factor (GEF) 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 77669
Homologene: 137396
Ccdc148
Name: coiled-coil domain containing 148
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227933
Homologene: 16353
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241116
Homologene: 28093
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: IGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 329421
Homologene: 51393
Shroom1
Name: shroom family member 1
Synonyms: Apx, 1300007L22Rik, Shrm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 71774
Homologene: 12411
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Olfr347
Name: olfactory receptor 347
Synonyms: MOR136-9, GA_x6K02T2NLDC-33428755-33429693
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258945
Homologene: 51790
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Zfp811
Name: zinc finger protein 811
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240063
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: Opo, ojoplano
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218165
VEGA: 13
Homologene: 125376
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237711
Homologene: 104282
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: FIST3, DYRK6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
Gm5828
Name: predicted gene 5828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545306
Olfr873
Name: olfactory receptor 873
Synonyms: GA_x6K02T2PVTD-14040245-14041204, MOR145-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258554
HGNC: HGNC:8396
Homologene: 115528
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Pcdhb14
Name: protocadherin beta 14
Synonyms: PcdhbN, 2210006M07Rik, Pcdhb17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93885
Homologene: 70876
Jkamp
Name: JNK1/MAPK8-associated membrane protein
Synonyms: 1200003C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 104771
Homologene: 9524
Stk25
Name: serine/threonine kinase 25 (yeast)
Synonyms: Ste20-like, SOK-1, 1500019J11Rik, Ysk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 59041
Homologene: 48428
Cpne7
Name: copine VII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 102278
HGNC: HGNC:2320
Homologene: 65128
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230612
Homologene: 17081
Mterf1b
Name: mitochondrial transcription termination factor 1b
Synonyms: Gm9897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 208595
Homologene: 5073
Wdr86
Name: WD repeat domain 86
Synonyms: 2810046M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 269633
Homologene: 90112
Tspan10
Name: tetraspanin 10
Synonyms: Ocsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 208634
Homologene: 49972
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: IAP, Akp-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11648
Homologene: 134333
Gucd1
Name: guanylyl cyclase domain containing 1
Synonyms: 1110038D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 68778
Homologene: 57149
Oxct2b
Name: 3-oxoacid CoA transferase 2B
Synonyms: Scot-t2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 353371
Homologene: 137359
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 320718
Homologene: 14179
Haao
Name: 3-hydroxyanthranilate 3,4-dioxygenase
Synonyms: 0610007K21Rik, 3HAO, 0610012J07Rik, 3-HAOxase, 3-HAO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 107766
VEGA: 17
HGNC: HGNC:4796
Homologene: 8148
H2-Q7
Name: histocompatibility 2, Q region locus 7
Synonyms: H-2Q7, Ped, Qa7, Qa-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 15018
HGNC: HGNC:4931
Homologene: 128352
Pcsk1
Name: proprotein convertase subtilisin/kexin type 1
Synonyms: Phpp-1, PC3, prohormone convertase 1/3, SPC3, PC1, Nec1, Nec-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 18548
HGNC: HGNC:8743
Homologene: 379
Amy2b
Name: amylase 2b
Synonyms: mAmy2-1, Amy2-2, Amy-X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 545562
Ifi204
Name: interferon activated gene 204
Synonyms: p204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 15951
HGNC: HGNC:5395
Homologene: 115929
AI429214
Name: expressed sequence AI429214
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 621080
Homologene: 82747
Ccin
Name: calicin
Synonyms: 4933417A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 442829
HGNC: HGNC:1568
Homologene: 4306
Lpo
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 76113
HGNC: HGNC:6678
Homologene: 21240
Ptgir
Name: prostaglandin I receptor (IP)
Synonyms: prostacyclin receptor, IP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 19222
HGNC: HGNC:9602
Homologene: 7496
Il1f6
Name: interleukin 1 family, member 6
Synonyms: Fil1, Fil1epsilon, IL-1H1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 54448
Homologene: 8688
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: Clecsf10, dectin-2, Nkcl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 56620
Homologene: 84615
Ifi211
Name: interferon activated gene 211
Synonyms: Ifi205b, Mnda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381308
HGNC: HGNC:5395
Homologene: 115929
Cav2
Name: caveolin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12390
HGNC: HGNC:1528
Homologene: 942
Cd8b1
Name: CD8 antigen, beta chain 1
Synonyms: Lyt-3, Ly-3, Ly-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12526
HGNC: HGNC:1707
Homologene: 3621
Tcp10b
Name: t-complex protein 10b
Synonyms: Tcp-10bt, T66B-a, D17Leh66ba, Tcp-10b, D17Leh66B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 21462
Homologene: 83254
Hist3h2ba
Name: histone cluster 3, H2ba
Synonyms: 1500011O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 78303
Homologene: 134740
Wfdc18
Name: WAP four-disulfide core domain 18
Synonyms: Kal1, WDNM1, Expi
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14038
Dcaf15
Name: DDB1 and CUL4 associated factor 15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 212123
Homologene: 18182
Cyp2ab1
Name: cytochrome P450, family 2, subfamily ab, polypeptide 1
Synonyms: EG224044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224044
Homologene: 120487
Krtap5-4
Name: keratin associated protein 5-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 50775
Ppp2r3d
Name: protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta
Synonyms: Ppp2r3a, PR59, Ppp2r3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
Gm14149
Name: predicted gene 14149
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 100038513
Gm13889
Name: predicted gene 13889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 620695
Homologene: 83963
Gm5866
Name: predicted gene 5866
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 545750
Ighv5-12-4
Name: immunoglobulin heavy variable 5-12-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 628098
RP23-243M12.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
Gm15518
Name: predicted gene 15518
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 102633939
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 11,065,825 bp
  • T to A, chromosome 1 at 16,769,418 bp
  • T to A, chromosome 1 at 20,364,167 bp
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp
  • T to A, chromosome 1 at 74,925,354 bp
  • A to G, chromosome 1 at 87,125,834 bp
  • A to T, chromosome 1 at 93,625,656 bp
  • T to C, chromosome 1 at 131,753,138 bp
  • A to G, chromosome 1 at 150,624,550 bp
  • C to A, chromosome 1 at 173,760,361 bp
  • A to G, chromosome 1 at 173,907,660 bp
  • T to A, chromosome 2 at 24,224,404 bp
  • T to A, chromosome 2 at 36,734,403 bp
  • G to T, chromosome 2 at 59,001,888 bp
  • C to A, chromosome 2 at 69,466,993 bp
  • T to C, chromosome 2 at 70,238,899 bp
  • G to T, chromosome 2 at 93,956,576 bp
  • C to T, chromosome 2 at 104,433,759 bp
  • C to T, chromosome 2 at 119,775,006 bp
  • A to G, chromosome 2 at 143,070,973 bp
  • A to T, chromosome 2 at 144,536,336 bp
  • A to T, chromosome 2 at 151,230,764 bp
  • T to A, chromosome 2 at 162,933,427 bp
  • T to G, chromosome 3 at 86,737,164 bp
  • C to T, chromosome 3 at 113,153,477 bp
  • C to A, chromosome 3 at 133,234,681 bp
  • A to G, chromosome 3 at 154,256,584 bp
  • A to T, chromosome 4 at 43,984,981 bp
  • A to T, chromosome 4 at 48,051,522 bp
  • G to A, chromosome 4 at 65,314,796 bp
  • C to A, chromosome 4 at 111,891,744 bp
  • A to T, chromosome 4 at 118,397,669 bp
  • T to C, chromosome 4 at 123,117,133 bp
  • A to G, chromosome 4 at 145,074,842 bp
  • T to A, chromosome 5 at 4,197,176 bp
  • A to T, chromosome 5 at 24,718,231 bp
  • T to G, chromosome 5 at 33,901,813 bp
  • G to T, chromosome 5 at 41,818,612 bp
  • G to A, chromosome 5 at 52,582,920 bp
  • T to A, chromosome 5 at 130,231,774 bp
  • T to A, chromosome 5 at 148,352,399 bp
  • A to T, chromosome 6 at 17,281,410 bp
  • C to T, chromosome 6 at 71,329,774 bp
  • T to C, chromosome 6 at 123,232,196 bp
  • A to G, chromosome 7 at 16,907,146 bp
  • T to C, chromosome 7 at 112,149,046 bp
  • T to C, chromosome 7 at 119,457,168 bp
  • T to A, chromosome 7 at 119,640,694 bp
  • G to T, chromosome 7 at 126,374,302 bp
  • T to A, chromosome 7 at 142,303,754 bp
  • A to T, chromosome 8 at 33,335,991 bp
  • T to A, chromosome 8 at 36,994,391 bp
  • A to C, chromosome 8 at 84,102,838 bp
  • T to A, chromosome 8 at 104,615,226 bp
  • T to A, chromosome 8 at 123,134,575 bp
  • G to A, chromosome 9 at 14,866,983 bp
  • A to C, chromosome 9 at 20,300,623 bp
  • A to G, chromosome 9 at 32,322,677 bp
  • A to G, chromosome 9 at 46,269,872 bp
  • T to C, chromosome 9 at 59,875,416 bp
  • T to C, chromosome 9 at 72,611,692 bp
  • A to G, chromosome 9 at 124,476,821 bp
  • T to A, chromosome 10 at 7,705,684 bp
  • T to C, chromosome 10 at 8,725,660 bp
  • T to C, chromosome 10 at 75,511,125 bp
  • T to A, chromosome 10 at 80,233,014 bp
  • T to A, chromosome 10 at 81,367,552 bp
  • T to C, chromosome 10 at 84,992,137 bp
  • A to G, chromosome 10 at 128,353,137 bp
  • A to T, chromosome 11 at 17,946,964 bp
  • A to T, chromosome 11 at 29,805,108 bp
  • T to C, chromosome 11 at 53,465,588 bp
  • C to T, chromosome 11 at 58,948,971 bp
  • T to A, chromosome 11 at 59,042,290 bp
  • A to G, chromosome 11 at 65,005,452 bp
  • C to A, chromosome 11 at 83,709,869 bp
  • T to C, chromosome 11 at 87,814,347 bp
  • C to A, chromosome 11 at 95,277,598 bp
  • A to T, chromosome 11 at 120,013,478 bp
  • A to G, chromosome 11 at 120,444,498 bp
  • A to G, chromosome 12 at 4,713,197 bp
  • G to T, chromosome 12 at 72,094,049 bp
  • A to T, chromosome 12 at 113,762,267 bp
  • A to T, chromosome 12 at 118,192,427 bp
  • T to C, chromosome 13 at 21,183,760 bp
  • G to A, chromosome 13 at 40,015,388 bp
  • T to A, chromosome 13 at 75,132,235 bp
  • C to T, chromosome 13 at 81,405,364 bp
  • C to T, chromosome 14 at 50,950,871 bp
  • A to G, chromosome 14 at 54,643,047 bp
  • G to A, chromosome 15 at 44,547,347 bp
  • A to T, chromosome 16 at 20,313,072 bp
  • A to T, chromosome 16 at 49,172,058 bp
  • A to G, chromosome 16 at 49,762,594 bp
  • A to T, chromosome 16 at 78,547,926 bp
  • A to G, chromosome 16 at 94,262,698 bp
  • T to A, chromosome 17 at 13,073,617 bp
  • T to A, chromosome 17 at 27,890,105 bp
  • T to A, chromosome 17 at 31,108,434 bp
  • C to A, chromosome 17 at 32,800,923 bp
  • T to A, chromosome 17 at 35,442,759 bp
  • T to C, chromosome 17 at 65,852,691 bp
  • A to T, chromosome 17 at 83,450,948 bp
  • A to T, chromosome 17 at 83,832,345 bp
  • A to G, chromosome 18 at 37,448,847 bp
  • T to A, chromosome X at 97,341,633 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4657 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041917-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.