Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4657Btlr/Mmmh
Stock Number:
041917-MU
Citation ID:
RRID:MMRRC_041917-MU
Other Names:
R4657 (G1), C57BL/6J-MtgxR4657Btlr
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Gpr83
Name: G protein-coupled receptor 83
Synonyms: RP105, RP82, RP39, glucocorticoid-induced receptor, GIR, Gpr72, Gir
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14608
HGNC: HGNC:4523
Homologene: 7732
Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, Apoav, 1300007O05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66113
Homologene: 14197
Spns1
Name: SPNS lysolipid transporter 1, lysophospholipid
Synonyms: 2210013K02Rik, spinster homolog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73658
Homologene: 41530
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 11,065,825 bp
  • T to A, chromosome 1 at 16,769,418 bp
  • T to A, chromosome 1 at 20,364,167 bp
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp
  • T to A, chromosome 1 at 74,925,354 bp
  • A to G, chromosome 1 at 87,125,834 bp
  • A to T, chromosome 1 at 93,625,656 bp
  • T to C, chromosome 1 at 131,753,138 bp
  • A to G, chromosome 1 at 150,624,550 bp
  • C to A, chromosome 1 at 173,760,361 bp
  • A to G, chromosome 1 at 173,907,660 bp
  • T to A, chromosome 2 at 24,224,404 bp
  • T to A, chromosome 2 at 36,734,403 bp
  • G to T, chromosome 2 at 59,001,888 bp
  • C to A, chromosome 2 at 69,466,993 bp
  • T to C, chromosome 2 at 70,238,899 bp
  • G to T, chromosome 2 at 93,956,576 bp
  • C to T, chromosome 2 at 104,433,759 bp
  • C to T, chromosome 2 at 119,775,006 bp
  • A to G, chromosome 2 at 143,070,973 bp
  • A to T, chromosome 2 at 144,536,336 bp
  • A to T, chromosome 2 at 151,230,764 bp
  • T to A, chromosome 2 at 162,933,427 bp
  • T to G, chromosome 3 at 86,737,164 bp
  • C to T, chromosome 3 at 113,153,477 bp
  • C to A, chromosome 3 at 133,234,681 bp
  • A to G, chromosome 3 at 154,256,584 bp
  • A to T, chromosome 4 at 43,984,981 bp
  • A to T, chromosome 4 at 48,051,522 bp
  • G to A, chromosome 4 at 65,314,796 bp
  • C to A, chromosome 4 at 111,891,744 bp
  • A to T, chromosome 4 at 118,397,669 bp
  • T to C, chromosome 4 at 123,117,133 bp
  • A to G, chromosome 4 at 145,074,842 bp
  • T to A, chromosome 5 at 4,197,176 bp
  • A to T, chromosome 5 at 24,718,231 bp
  • T to G, chromosome 5 at 33,901,813 bp
  • G to T, chromosome 5 at 41,818,612 bp
  • G to A, chromosome 5 at 52,582,920 bp
  • T to A, chromosome 5 at 130,231,774 bp
  • T to A, chromosome 5 at 148,352,399 bp
  • A to T, chromosome 6 at 17,281,410 bp
  • C to T, chromosome 6 at 71,329,774 bp
  • T to C, chromosome 6 at 123,232,196 bp
  • A to G, chromosome 7 at 16,907,146 bp
  • T to C, chromosome 7 at 112,149,046 bp
  • T to C, chromosome 7 at 119,457,168 bp
  • T to A, chromosome 7 at 119,640,694 bp
  • G to T, chromosome 7 at 126,374,302 bp
  • T to A, chromosome 7 at 142,303,754 bp
  • A to T, chromosome 8 at 33,335,991 bp
  • T to A, chromosome 8 at 36,994,391 bp
  • A to C, chromosome 8 at 84,102,838 bp
  • T to A, chromosome 8 at 104,615,226 bp
  • T to A, chromosome 8 at 123,134,575 bp
  • G to A, chromosome 9 at 14,866,983 bp
  • A to C, chromosome 9 at 20,300,623 bp
  • A to G, chromosome 9 at 32,322,677 bp
  • A to G, chromosome 9 at 46,269,872 bp
  • T to C, chromosome 9 at 59,875,416 bp
  • T to C, chromosome 9 at 72,611,692 bp
  • A to G, chromosome 9 at 124,476,821 bp
  • T to A, chromosome 10 at 7,705,684 bp
  • T to C, chromosome 10 at 8,725,660 bp
  • T to C, chromosome 10 at 75,511,125 bp
  • T to A, chromosome 10 at 80,233,014 bp
  • T to A, chromosome 10 at 81,367,552 bp
  • T to C, chromosome 10 at 84,992,137 bp
  • A to G, chromosome 10 at 128,353,137 bp
  • A to T, chromosome 11 at 17,946,964 bp
  • A to T, chromosome 11 at 29,805,108 bp
  • T to C, chromosome 11 at 53,465,588 bp
  • C to T, chromosome 11 at 58,948,971 bp
  • T to A, chromosome 11 at 59,042,290 bp
  • A to G, chromosome 11 at 65,005,452 bp
  • C to A, chromosome 11 at 83,709,869 bp
  • T to C, chromosome 11 at 87,814,347 bp
  • C to A, chromosome 11 at 95,277,598 bp
  • A to T, chromosome 11 at 120,013,478 bp
  • A to G, chromosome 11 at 120,444,498 bp
  • A to G, chromosome 12 at 4,713,197 bp
  • G to T, chromosome 12 at 72,094,049 bp
  • A to T, chromosome 12 at 113,762,267 bp
  • A to T, chromosome 12 at 118,192,427 bp
  • T to C, chromosome 13 at 21,183,760 bp
  • G to A, chromosome 13 at 40,015,388 bp
  • T to A, chromosome 13 at 75,132,235 bp
  • C to T, chromosome 13 at 81,405,364 bp
  • C to T, chromosome 14 at 50,950,871 bp
  • A to G, chromosome 14 at 54,643,047 bp
  • G to A, chromosome 15 at 44,547,347 bp
  • A to T, chromosome 16 at 20,313,072 bp
  • A to T, chromosome 16 at 49,172,058 bp
  • A to G, chromosome 16 at 49,762,594 bp
  • A to T, chromosome 16 at 78,547,926 bp
  • A to G, chromosome 16 at 94,262,698 bp
  • T to A, chromosome 17 at 13,073,617 bp
  • T to A, chromosome 17 at 27,890,105 bp
  • T to A, chromosome 17 at 31,108,434 bp
  • C to A, chromosome 17 at 32,800,923 bp
  • T to A, chromosome 17 at 35,442,759 bp
  • T to C, chromosome 17 at 65,852,691 bp
  • A to T, chromosome 17 at 83,450,948 bp
  • A to T, chromosome 17 at 83,832,345 bp
  • A to G, chromosome 18 at 37,448,847 bp
  • T to A, chromosome X at 97,341,633 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4657 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041917-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.