Strain Name:
C57BL/6J-MtgxR4657Btlr/Mmmh
Stock Number:
041917-MU
Citation ID:
RRID:MMRRC_041917-MU
Other Names:
R4657 (G1), C57BL/6J-MtgxR4657Btlr
Major Collection:

Gene Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 22427
Homologene: 6659
Gpr83
Name: G protein-coupled receptor 83
Synonyms: RP105, RP82, RP39, glucocorticoid-induced receptor, GIR, Gpr72, Gir
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14608
HGNC: HGNC:4523
Homologene: 7732
Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, Apoav, 1300007O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66113
Homologene: 14197
Spns1
Name: spinster homolog 1
Synonyms: 2210013K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73658
Homologene: 41530
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70097
Homologene: 69182
Fzr1
Name: fizzy and cell division cycle 20 related 1
Synonyms: Fyr, Cdh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56371
Homologene: 9444
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Tmem248
Name: transmembrane protein 248
Synonyms: G430067H08Rik, A930023A16Rik, 0610007L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71667
Homologene: 9951
Cs
Name: citrate synthase
Synonyms: Cis, 2610511A05Rik, 9030605P22Rik, ahl4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12974
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 109294
Homologene: 23523
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68145
Homologene: 10369
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68925
Homologene: 32269
Kat7
Name: K(lysine) acetyltransferase 7
Synonyms: Hbo1, Hboa, Myst2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217127
Homologene: 5134
Uhrf1bp1
Name: UHRF1 (ICBP90) binding protein 1
Synonyms: 1110020K19Rik, F830021D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224648
Homologene: 9816
Ric8b
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8, Ric-8b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237422
VEGA: 10
Homologene: 23080
Dkk3
Name: dickkopf WNT signaling pathway inhibitor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50781
HGNC: HGNC:2893
Homologene: 8303
Abcg1
Name: ATP binding cassette subfamily G member 1
Synonyms: White, Abc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 11307
HGNC: HGNC:73
Homologene: 21022
Trim27
Name: tripartite motif-containing 27
Synonyms: Rfp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19720
HGNC: HGNC:9975
Homologene: 111010
Polr3f
Name: polymerase (RNA) III (DNA directed) polypeptide F
Synonyms: 3110032A07Rik, 2810411G20Rik, RPC39, RPC6, 3010019O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70408
Homologene: 4722
Snrpb2
Name: U2 small nuclear ribonucleoprotein B
Synonyms: 2810052G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20639
Homologene: 37728
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: 2610036I19Rik, 2610510L13Rik, Acinus
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 56215
Homologene: 22853
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 665775
Homologene: 45109
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230895
Homologene: 15583
Ralbp1
Name: ralA binding protein 1
Synonyms: Rip1, RLIP76
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19765
VEGA: 17
HGNC: HGNC:9841
Homologene: 4940
D16Ertd472e
Name: DNA segment, Chr 16, ERATO Doi 472, expressed
Synonyms: 2310009O17Rik, E330003K22Rik, 1700010I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67102
Homologene: 9696
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 24116
Homologene: 68478
Srsf6
Name: serine and arginine-rich splicing factor 6
Synonyms: 1210001E11Rik, Sfrs6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67996
Homologene: 110783
Pwwp3a
Name: PWWP domain containing 3A, DNA repair factor
Synonyms: 9430059D04Rik, Mum1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68114
Homologene: 11349
Arhgap44
Name: Rho GTPase activating protein 44
Synonyms: AU040829
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216831
Homologene: 65284
Rfx7
Name: regulatory factor X, 7
Synonyms: 2510005N23Rik, 9930116O05Rik, D130086K05Rik, Rfxdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319758
Homologene: 11275
Eda2r
Name: ectodysplasin A2 receptor
Synonyms: 9430060M22Rik, Xedar
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245527
Homologene: 11033
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230676
Homologene: 49413
Nr4a3
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: TEC, NOR-1, Nor1, MINOR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18124
HGNC: HGNC:7982
Homologene: 5074
Gp2
Name: glycoprotein 2 (zymogen granule membrane)
Synonyms: 2310037I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67133
HGNC: HGNC:4441
Homologene: 133790
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1203Clo, b2b1279Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: Rev-1, Rec-1, Atrc-1, Atrc1, 4831426K01Rik, mCAT-1, Cat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11987
Homologene: 20658
Cdh16
Name: cadherin 16
Synonyms: KSP-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12556
HGNC: HGNC:1755
Homologene: 2997
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 117147
Homologene: 24930
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242259
Homologene: 72094
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Arhgef38
Name: Rho guanine nucleotide exchange factor (GEF) 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 77669
Homologene: 137396
Ccdc148
Name: coiled-coil domain containing 148
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227933
Homologene: 16353
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241116
Homologene: 28093
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAG1, IGFBP-4ase, PAPP-A, 8430414N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329421
Homologene: 51393
Shroom1
Name: shroom family member 1
Synonyms: 1300007L22Rik, Shrm1, Apx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71774
Homologene: 12411
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Olfr347
Name: olfactory receptor 347
Synonyms: GA_x6K02T2NLDC-33428755-33429693, MOR136-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258945
Homologene: 51790
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Zfp811
Name: zinc finger protein 811
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240063
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218165
VEGA: 13
Homologene: 125376
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237711
Homologene: 104282
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
Gm5828
Name: predicted gene 5828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545306
Olfr873
Name: olfactory receptor 873
Synonyms: GA_x6K02T2PVTD-14040245-14041204, MOR145-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258554
HGNC: HGNC:8396
Homologene: 115528
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Pcdhb14
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93885
Homologene: 70876
Jkamp
Name: JNK1/MAPK8-associated membrane protein
Synonyms: 1200003C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104771
Homologene: 9524
Stk25
Name: serine/threonine kinase 25 (yeast)
Synonyms: Ste20-like, Ysk1, 1500019J11Rik, SOK-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 59041
Homologene: 48428
Cpne7
Name: copine VII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102278
HGNC: HGNC:2320
Homologene: 65128
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230612
Homologene: 17081
Mterf1b
Name: mitochondrial transcription termination factor 1b
Synonyms: Gm9897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208595
Homologene: 5073
Wdr86
Name: WD repeat domain 86
Synonyms: 2810046M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269633
Homologene: 90112
Tspan10
Name: tetraspanin 10
Synonyms: Ocsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 208634
Homologene: 49972
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: IAP, Akp-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11648
Homologene: 134333
Gucd1
Name: guanylyl cyclase domain containing 1
Synonyms: 1110038D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68778
Homologene: 57149
Oxct2b
Name: 3-oxoacid CoA transferase 2B
Synonyms: Scot-t2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 353371
Homologene: 137359
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Haao
Name: 3-hydroxyanthranilate 3,4-dioxygenase
Synonyms: 0610007K21Rik, 0610012J07Rik, 3-HAO, 3HAO, 3-HAOxase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 107766
VEGA: 17
HGNC: HGNC:4796
Homologene: 8148
H2-Q7
Name: histocompatibility 2, Q region locus 7
Synonyms: H-2Q7, Qa-7, Qa7, Ped
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15018
HGNC: HGNC:4931
Homologene: 128352
Pcsk1
Name: proprotein convertase subtilisin/kexin type 1
Synonyms: PC3, prohormone convertase 1/3, Nec-1, Nec1, PC1, SPC3, Phpp-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18548
HGNC: HGNC:8743
Homologene: 379
Amy2b
Name: amylase 2b
Synonyms: Amy-X, mAmy2-1, Amy2-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 545562
Ifi204
Name: interferon activated gene 204
Synonyms: p204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15951
HGNC: HGNC:5395
Homologene: 115929
AI429214
Name: expressed sequence AI429214
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 621080
Homologene: 82747
Ccin
Name: calicin
Synonyms: 4933417A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 442829
HGNC: HGNC:1568
Homologene: 4306
Lpo
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76113
HGNC: HGNC:6678
Homologene: 21240
Ptgir
Name: prostaglandin I receptor (IP)
Synonyms: prostacyclin receptor, IP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19222
HGNC: HGNC:9602
Homologene: 7496
Il36a
Name: interleukin 36A
Synonyms: IL-1H1, Fil1, Fil1epsilon, Il1f6, If36a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 54448
Homologene: 8688
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: dectin-2, Clecsf10, Nkcl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56620
Homologene: 84615
Ifi211
Name: interferon activated gene 211
Synonyms: Mnda, Ifi205b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381308
HGNC: HGNC:5395
Homologene: 115929
Cav2
Name: caveolin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12390
HGNC: HGNC:1528
Homologene: 942
Cd8b1
Name: CD8 antigen, beta chain 1
Synonyms: Ly-C, Ly-3, Lyt-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12526
HGNC: HGNC:1707
Homologene: 3621
Tcp10b
Name: t-complex protein 10b
Synonyms: T66B-a, D17Leh66ba, D17Leh66B, Tcp-10b, Tcp-10bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21462
Homologene: 83254
H2bu2
Name: H2B.U histone 2
Synonyms: 1500011O09Rik, Hist3h2ba
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78303
Homologene: 134740
Wfdc18
Name: WAP four-disulfide core domain 18
Synonyms: WDNM1, Kal1, Expi
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14038
Dcaf15
Name: DDB1 and CUL4 associated factor 15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212123
Homologene: 18182
Cyp2ab1
Name: cytochrome P450, family 2, subfamily ab, polypeptide 1
Synonyms: EG224044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224044
Homologene: 120487
Krtap5-4
Name: keratin associated protein 5-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50775
Ppp2r3d
Name: protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta
Synonyms: PR59, Ppp2r3, Ppp2r3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Gm14149
Name: predicted gene 14149
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100038513
Gm13889
Name: predicted gene 13889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 620695
Homologene: 83963
Gm5866
Name: predicted gene 5866
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 545750
Ighv5-12-4
Name: immunoglobulin heavy variable 5-12-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 628098
RP23-243M12.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Gm15518
Name: predicted gene 15518
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 102633939
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 11,065,825 bp
  • T to A, chromosome 1 at 16,769,418 bp
  • T to A, chromosome 1 at 20,364,167 bp
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp
  • T to A, chromosome 1 at 74,925,354 bp
  • A to G, chromosome 1 at 87,125,834 bp
  • A to T, chromosome 1 at 93,625,656 bp
  • T to C, chromosome 1 at 131,753,138 bp
  • A to G, chromosome 1 at 150,624,550 bp
  • C to A, chromosome 1 at 173,760,361 bp
  • A to G, chromosome 1 at 173,907,660 bp
  • T to A, chromosome 2 at 24,224,404 bp
  • T to A, chromosome 2 at 36,734,403 bp
  • G to T, chromosome 2 at 59,001,888 bp
  • C to A, chromosome 2 at 69,466,993 bp
  • T to C, chromosome 2 at 70,238,899 bp
  • G to T, chromosome 2 at 93,956,576 bp
  • C to T, chromosome 2 at 104,433,759 bp
  • C to T, chromosome 2 at 119,775,006 bp
  • A to G, chromosome 2 at 143,070,973 bp
  • A to T, chromosome 2 at 144,536,336 bp
  • A to T, chromosome 2 at 151,230,764 bp
  • T to A, chromosome 2 at 162,933,427 bp
  • T to G, chromosome 3 at 86,737,164 bp
  • C to T, chromosome 3 at 113,153,477 bp
  • C to A, chromosome 3 at 133,234,681 bp
  • A to G, chromosome 3 at 154,256,584 bp
  • A to T, chromosome 4 at 43,984,981 bp
  • A to T, chromosome 4 at 48,051,522 bp
  • G to A, chromosome 4 at 65,314,796 bp
  • C to A, chromosome 4 at 111,891,744 bp
  • A to T, chromosome 4 at 118,397,669 bp
  • T to C, chromosome 4 at 123,117,133 bp
  • A to G, chromosome 4 at 145,074,842 bp
  • T to A, chromosome 5 at 4,197,176 bp
  • A to T, chromosome 5 at 24,718,231 bp
  • T to G, chromosome 5 at 33,901,813 bp
  • G to T, chromosome 5 at 41,818,612 bp
  • G to A, chromosome 5 at 52,582,920 bp
  • T to A, chromosome 5 at 130,231,774 bp
  • T to A, chromosome 5 at 148,352,399 bp
  • A to T, chromosome 6 at 17,281,410 bp
  • C to T, chromosome 6 at 71,329,774 bp
  • T to C, chromosome 6 at 123,232,196 bp
  • A to G, chromosome 7 at 16,907,146 bp
  • T to C, chromosome 7 at 112,149,046 bp
  • T to C, chromosome 7 at 119,457,168 bp
  • T to A, chromosome 7 at 119,640,694 bp
  • G to T, chromosome 7 at 126,374,302 bp
  • T to A, chromosome 7 at 142,303,754 bp
  • A to T, chromosome 8 at 33,335,991 bp
  • T to A, chromosome 8 at 36,994,391 bp
  • A to C, chromosome 8 at 84,102,838 bp
  • T to A, chromosome 8 at 104,615,226 bp
  • T to A, chromosome 8 at 123,134,575 bp
  • G to A, chromosome 9 at 14,866,983 bp
  • A to C, chromosome 9 at 20,300,623 bp
  • A to G, chromosome 9 at 32,322,677 bp
  • A to G, chromosome 9 at 46,269,872 bp
  • T to C, chromosome 9 at 59,875,416 bp
  • T to C, chromosome 9 at 72,611,692 bp
  • A to G, chromosome 9 at 124,476,821 bp
  • T to A, chromosome 10 at 7,705,684 bp
  • T to C, chromosome 10 at 8,725,660 bp
  • T to C, chromosome 10 at 75,511,125 bp
  • T to A, chromosome 10 at 80,233,014 bp
  • T to A, chromosome 10 at 81,367,552 bp
  • T to C, chromosome 10 at 84,992,137 bp
  • A to G, chromosome 10 at 128,353,137 bp
  • A to T, chromosome 11 at 17,946,964 bp
  • A to T, chromosome 11 at 29,805,108 bp
  • T to C, chromosome 11 at 53,465,588 bp
  • C to T, chromosome 11 at 58,948,971 bp
  • T to A, chromosome 11 at 59,042,290 bp
  • A to G, chromosome 11 at 65,005,452 bp
  • C to A, chromosome 11 at 83,709,869 bp
  • T to C, chromosome 11 at 87,814,347 bp
  • C to A, chromosome 11 at 95,277,598 bp
  • A to T, chromosome 11 at 120,013,478 bp
  • A to G, chromosome 11 at 120,444,498 bp
  • A to G, chromosome 12 at 4,713,197 bp
  • G to T, chromosome 12 at 72,094,049 bp
  • A to T, chromosome 12 at 113,762,267 bp
  • A to T, chromosome 12 at 118,192,427 bp
  • T to C, chromosome 13 at 21,183,760 bp
  • G to A, chromosome 13 at 40,015,388 bp
  • T to A, chromosome 13 at 75,132,235 bp
  • C to T, chromosome 13 at 81,405,364 bp
  • C to T, chromosome 14 at 50,950,871 bp
  • A to G, chromosome 14 at 54,643,047 bp
  • G to A, chromosome 15 at 44,547,347 bp
  • A to T, chromosome 16 at 20,313,072 bp
  • A to T, chromosome 16 at 49,172,058 bp
  • A to G, chromosome 16 at 49,762,594 bp
  • A to T, chromosome 16 at 78,547,926 bp
  • A to G, chromosome 16 at 94,262,698 bp
  • T to A, chromosome 17 at 13,073,617 bp
  • T to A, chromosome 17 at 27,890,105 bp
  • T to A, chromosome 17 at 31,108,434 bp
  • C to A, chromosome 17 at 32,800,923 bp
  • T to A, chromosome 17 at 35,442,759 bp
  • T to C, chromosome 17 at 65,852,691 bp
  • A to T, chromosome 17 at 83,450,948 bp
  • A to T, chromosome 17 at 83,832,345 bp
  • A to G, chromosome 18 at 37,448,847 bp
  • T to A, chromosome X at 97,341,633 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4657 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041917-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.