Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4673Btlr/Mmmh
Stock Number:
041928-MU
Citation ID:
RRID:MMRRC_041928-MU
Other Names:
R4673 (G1), C57BL/6J-MtgxR4673Btlr
Major Collection:

Strain Information

Rnd3
Name: Rho family GTPase 3
Synonyms: 2610017M01Rik, Arhe, Rhoe
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74194
HGNC: HGNC:671
Homologene: 21074
Crlf3
Name: cytokine receptor-like factor 3
Synonyms: cytor4, Creme9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54394
Homologene: 9327
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, 4933438D16Rik, 4933439E17Rik, 4930513H15Rik, D14Ertd581e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Snd1
Name: staphylococcal nuclease and tudor domain containing 1
Synonyms: p100 co-activator, Tudor-SN
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56463
Homologene: 8665
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 60,329,390 bp
  • T to C, chromosome 1 at 93,714,866 bp
  • G to A, chromosome 1 at 150,423,567 bp
  • A to G, chromosome 1 at 174,191,062 bp
  • A to G, chromosome 2 at 24,631,944 bp
  • A to G, chromosome 2 at 28,572,224 bp
  • A to T, chromosome 2 at 37,645,679 bp
  • A to G, chromosome 2 at 43,679,803 bp
  • G to A, chromosome 2 at 51,132,541 bp
  • A to G, chromosome 2 at 135,932,271 bp
  • G to A, chromosome 2 at 180,199,266 bp
  • A to T, chromosome 3 at 85,730,713 bp
  • T to A, chromosome 3 at 122,014,971 bp
  • T to G, chromosome 4 at 11,579,841 bp
  • T to A, chromosome 4 at 11,609,449 bp
  • T to C, chromosome 4 at 43,563,192 bp
  • T to C, chromosome 4 at 43,836,430 bp
  • G to A, chromosome 4 at 134,200,347 bp
  • A to G, chromosome 4 at 134,934,493 bp
  • C to T, chromosome 4 at 139,410,716 bp
  • T to A, chromosome 4 at 152,318,462 bp
  • A to T, chromosome 5 at 115,251,089 bp
  • G to T, chromosome 5 at 121,887,476 bp
  • A to G, chromosome 5 at 122,373,918 bp
  • A to G, chromosome 6 at 4,629,975 bp
  • A to G, chromosome 6 at 11,992,057 bp
  • T to C, chromosome 6 at 28,724,921 bp
  • T to C, chromosome 6 at 113,327,307 bp
  • A to G, chromosome 6 at 146,373,173 bp
  • G to A, chromosome 7 at 29,534,760 bp
  • T to C, chromosome 7 at 29,845,438 bp
  • T to A, chromosome 7 at 44,624,330 bp
  • G to A, chromosome 7 at 126,591,079 bp
  • G to A, chromosome 8 at 19,693,688 bp
  • T to C, chromosome 8 at 24,884,455 bp
  • C to T, chromosome 8 at 40,824,731 bp
  • T to C, chromosome 8 at 83,295,247 bp
  • A to G, chromosome 9 at 19,585,430 bp
  • G to A, chromosome 9 at 56,136,696 bp
  • G to C, chromosome 9 at 59,640,110 bp
  • G to T, chromosome 9 at 106,236,477 bp
  • T to C, chromosome 10 at 19,011,832 bp
  • TCACCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCACCAC, chromosome 11 at 23,364,480 bp
  • A to G, chromosome 11 at 61,213,494 bp
  • T to A, chromosome 11 at 67,188,477 bp
  • T to C, chromosome 11 at 67,246,401 bp
  • A to T, chromosome 11 at 80,060,166 bp
  • A to G, chromosome 11 at 99,915,214 bp
  • T to A, chromosome 12 at 76,405,740 bp
  • A to T, chromosome 12 at 81,421,761 bp
  • A to T, chromosome 12 at 87,162,063 bp
  • G to A, chromosome 13 at 40,015,388 bp
  • G to T, chromosome 13 at 59,796,845 bp
  • C to T, chromosome 14 at 54,282,332 bp
  • A to G, chromosome 14 at 59,630,180 bp
  • T to G, chromosome 14 at 64,031,270 bp
  • C to A, chromosome 14 at 68,577,904 bp
  • A to G, chromosome 14 at 99,133,351 bp
  • T to A, chromosome 15 at 36,099,933 bp
  • T to C, chromosome 15 at 99,470,838 bp
  • T to C, chromosome 16 at 4,991,943 bp
  • C to T, chromosome 16 at 14,269,241 bp
  • C to T, chromosome 16 at 58,925,690 bp
  • C to T, chromosome 16 at 73,904,378 bp
  • T to A, chromosome 17 at 3,197,985 bp
  • A to G, chromosome 17 at 31,557,606 bp
  • A to G, chromosome 17 at 34,672,540 bp
  • T to A, chromosome 18 at 15,063,227 bp
  • G to A, chromosome 19 at 12,935,097 bp
  • T to A, chromosome 19 at 36,978,372 bp
  • T to C, chromosome 19 at 38,749,396 bp
  • T to A, chromosome X at 15,110,847 bp
  • T to G, chromosome X at 74,338,948 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4673 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041928-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.