Strain Name:
C57BL/6J-MtgxR4674Btlr/Mmmh
Stock Number:
041929-MU
Citation ID:
RRID:MMRRC_041929-MU
Other Names:
R4674 (G1), C57BL/6J-MtgxR4674Btlr
Major Collection:

Strain Information

Rpl13a
Name: ribosomal protein L13A
Synonyms: tum-antigen, tum-transplantation antigen P198, Tstap198-7, 1810026N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22121
Homologene: 111053
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Egf
Name: epidermal growth factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13645
HGNC: HGNC:3229
Homologene: 1483
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11426
Homologene: 136191
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 52463
Homologene: 12735
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: pCIP, TRAM-1, AIB1, RAC3, TRAM1, Src3, 2010305B15Rik, KAT13B, bHLHe42
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74737
Homologene: 32282
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Pipox
Name: pipecolic acid oxidase
Synonyms: Pso
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19193
Homologene: 40640
Macroh2a1
Name: macroH2A.1 histone
Synonyms: mH2a1, MACROH2A1.2, H2AF12M, H2afy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 26914
HGNC: HGNC:4740
Homologene: 3598
Slc29a1
Name: solute carrier family 29 (nucleoside transporters), member 1
Synonyms: ENT1, NBMPR-sensitive equilibrative nucleoside transporter, 1200014D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 63959
Homologene: 37985
Mapk14
Name: mitogen-activated protein kinase 14
Synonyms: p38-alpha, p38, p38 MAP Kinase, Mxi2, CSBP2, Crk1, Csbp1, p38MAPK, p38a, p38 alpha, p38alpha, p38 MAP kinase alpha, p38 MAPK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26416
HGNC: HGNC:6876
Homologene: 31777
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: 5730409A01Rik, 1810061H24Rik, SAP130, RSE1, D8Ertd633e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 101943
Homologene: 6579
Dido1
Name: death inducer-obliterator 1
Synonyms: DIO-1, 6720461J16Rik, D130048F08Rik, Datf1, dido, C130092D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Exoc6
Name: exocyst complex component 6
Synonyms: msec15, 4833405E05Rik, Sec15, Sec15l1, hbd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107371
VEGA: 19
Homologene: 41305
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57752
Homologene: 5087
Cpne1
Name: copine I
Synonyms: 1810028N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 266692
HGNC: HGNC:2314
Homologene: 36501
Ube4b
Name: ubiquitination factor E4B
Synonyms: UFD2, 4933406G05Rik, 4930551I19Rik, UFD2a, Ufd2p, D4Bwg0973e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 63958
Homologene: 107623
Acvr1b
Name: activin A receptor, type 1B
Synonyms: ActR-IB, Acvrlk4, SKR2, ActRIB, Alk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11479
HGNC: HGNC:172
Homologene: 20906
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 77097
Homologene: 64680
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51869
Homologene: 41231
Dhx16
Name: DEAH-box helicase 16
Synonyms: 2410006N22Rik, DBP2, Ddx16, DEAH (Asp-Glu-Ala-His) box polypeptide 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 69192
HGNC: HGNC:2739
Homologene: 2658
Cald1
Name: caldesmon 1
Synonyms: 4833423D12Rik, C920027I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 109624
HGNC: HGNC:1441
Homologene: 137254
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230249
Homologene: 6056
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Snap91
Name: synaptosomal-associated protein 91
Synonyms: F1-20, 91kDa, AP180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20616
Homologene: 8429
Aarsd1
Name: alanyl-tRNA synthetase domain containing 1
Synonyms: 2310044P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69684
Homologene: 6821
Plppr1
Name: phospholipid phosphatase related 1
Synonyms: PRG-3, E130309F12Rik, Lppr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 272031
Homologene: 9815
Clec1b
Name: C-type lectin domain family 1, member b
Synonyms: Clec-2, 1810061I13Rik, Clec2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56760
Homologene: 49468
Flrt2
Name: fibronectin leucine rich transmembrane protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 399558
HGNC: HGNC:3761
Homologene: 8291
Tia1
Name: cytotoxic granule-associated RNA binding protein 1
Synonyms: mTIA-1, 2310050N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21841
Homologene: 20692
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 50767
Homologene: 21333
Clstn1
Name: calsyntenin 1
Synonyms: calsyntenin-1, Cst-1, 1810034E21Rik, alcadein alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65945
Homologene: 8814
Wdr18
Name: WD repeat domain 18
Synonyms: 2310012I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216156
VEGA: 10
Homologene: 32573
Pnpla7
Name: patatin-like phospholipase domain containing 7
Synonyms: E430013P11Rik, NRE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241274
Homologene: 62431
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 211961
Homologene: 19371
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Fam184b
Name: family with sequence similarity 184, member B
Synonyms: 9630031F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 58227
Homologene: 137353
Cracr2b
Name: calcium release activated channel regulator 2B
Synonyms: 6330520A15Rik, Efcab4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 213573
Homologene: 45468
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, 9330153B10Rik, ZIZ3, A630054M16Rik, Zizimin3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210293
Homologene: 45952
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Krt73
Name: keratin 73
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223915
Homologene: 27875
Atp1a4
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 27222
Homologene: 113769
Or4c35
Name: olfactory receptor family 4 subfamily C member 35
Synonyms: GA_x6K02T2Q125-51409740-51410672, MOR232-2, Olfr1260
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258983
Homologene: 17455
Or51ab3
Name: olfactory receptor family 51 subfamily AB member 3
Synonyms: GA_x6K02T2PBJ9-6275524-6276477, GA_x6K02T2PBJ9-6271959-6272393, MOR20-1, MOR20-1, Olfr614, Olfr613
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259104
Homologene: 17505
Dcaf10
Name: DDB1 and CUL4 associated factor 10
Synonyms: Wdr32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242418
Homologene: 32581
Tdrd5
Name: tudor domain containing 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214575
Homologene: 18312
Syna
Name: syncytin a
Synonyms: syncytin-A, Gm52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 214292
Homologene: 86751
Naip1
Name: NLR family, apoptosis inhibitory protein 1
Synonyms: Naip, D13Lsd1, Birc1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17940
VEGA: 13
HGNC: HGNC:7634
Homologene: 113589
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: NG2, AN2, 4732461B14Rik, Cspg4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627132
Homologene: 129750
Heca
Name: hdc homolog, cell cycle regulator
Synonyms: LOC380629
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 380629
VEGA: 10
Homologene: 32300
Or52p1
Name: olfactory receptor family 52 subfamily P member 1
Synonyms: GA_x6K02T2PBJ9-7245486-7246451, MOR27-1, Olfr656
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259078
Homologene: 128072
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Cyp46a1
Name: cytochrome P450, family 46, subfamily a, polypeptide 1
Synonyms: cholestrol 24-hydroxylase, Cyp46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13116
VEGA: 12
HGNC: HGNC:2641
Homologene: 134501
F13b
Name: coagulation factor XIII, beta subunit
Synonyms: Cf-13b, Cf13b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14060
HGNC: HGNC:3534
Homologene: 1512
Ceacam15
Name: CEA cell adhesion molecule 15
Synonyms: C430002N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101434
Homologene: 131210
Zup1
Name: zinc finger containing ubiquitin peptidase 1
Synonyms: 2700019D07Rik, Zufsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 72580
VEGA: 10
Homologene: 12472
Efcab12
Name: EF-hand calcium binding domain 12
Synonyms: BC060267
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 212516
Homologene: 18905
Rimklb
Name: ribosomal modification protein rimK-like family member B
Synonyms: 4931417E21Rik, 4933426K21Rik, NAAGS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108653
Homologene: 18968
Or4c107
Name: olfactory receptor family 4 subfamily C member 107
Synonyms: GA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17, Olfr1212
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258241
Homologene: 66154
Hdac9
Name: histone deacetylase 9
Synonyms: HDRP, Hdac7b, Mitr, D030072B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 79221
Homologene: 128578
Stap1
Name: signal transducing adaptor family member 1
Synonyms: STAP-1, Brdg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56792
Homologene: 8103
Pgbd5
Name: piggyBac transposable element derived 5
Synonyms: 2900019M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 209966
Homologene: 11583
Igsf8
Name: immunoglobulin superfamily, member 8
Synonyms: ESTM34, EWI-2, PG regulatory-like protein, PGRL, KCT-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 140559
Homologene: 14163
Crbn
Name: cereblon
Synonyms: 2610203G15Rik, 2900045O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 58799
Homologene: 9461
Skint4
Name: selection and upkeep of intraepithelial T cells 4
Synonyms: 9530098N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 320640
Cd84
Name: CD84 antigen
Synonyms: CDw84, SLAMF5, A130013D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12523
HGNC: HGNC:1704
Homologene: 48249
Mgat5
Name: mannoside acetylglucosaminyltransferase 5
Synonyms: GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V, 5330407H02Rik, 4930471A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107895
HGNC: HGNC:7049
Homologene: 1808
Or5b111
Name: olfactory receptor family 5 subfamily B member 111
Synonyms: GA_x6K02T2RE5P-3645346-3644423, MOR202-28, Olfr1465
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258121
HGNC: HGNC:8324
Zfp112
Name: zinc finger protein 112
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57745
Homologene: 49338
Zfp873
Name: zinc finger protein 873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 408062
Homologene: 134319
Or5p72
Name: olfactory receptor family 5 subfamily P member 72
Synonyms: GA_x6K02T2PBJ9-10752603-10753547, MOR204-9, Olfr497
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258733
Homologene: 133602
Cbx2
Name: chromobox 2
Synonyms: M33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12416
HGNC: HGNC:1552
Homologene: 7256
Ephx1
Name: epoxide hydrolase 1, microsomal
Synonyms: Eph-1, Eph1, mEH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13849
HGNC: HGNC:3401
Homologene: 94
Ccdc82
Name: coiled-coil domain containing 82
Synonyms: 2310043N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66396
VEGA: 9
Homologene: 11678
Zscan2
Name: zinc finger and SCAN domain containing 2
Synonyms: Zfp-29, Zfp29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22691
Homologene: 56453
Ndn
Name: necdin, MAGE family member
Synonyms: Peg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17984
HGNC: HGNC:7675
Homologene: 20559
4933413J09Rik
Name: RIKEN cDNA 4933413J09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71106
Trav3-1
Name: T cell receptor alpha variable 3-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 667441
Gm6654
Name: predicted pseudogene 6654
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 626175
Tcstv7b
Name: Tcstv family member 7B
Synonyms: Gm21731
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Cebpd
Name: CCAAT/enhancer binding protein delta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12609
HGNC: HGNC:1835
Homologene: 3808
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,606,620 bp
  • T to C, chromosome 1 at 118,836,029 bp
  • T to A, chromosome 1 at 127,390,758 bp
  • A to G, chromosome 1 at 132,463,390 bp
  • A to G, chromosome 1 at 139,501,804 bp
  • A to C, chromosome 1 at 156,277,435 bp
  • A to T, chromosome 1 at 171,873,320 bp
  • A to T, chromosome 1 at 172,257,656 bp
  • G to A, chromosome 1 at 172,318,912 bp
  • A to G, chromosome 1 at 180,994,691 bp
  • T to C, chromosome 2 at 25,052,317 bp
  • C to T, chromosome 2 at 31,454,812 bp
  • T to A, chromosome 2 at 52,106,942 bp
  • G to T, chromosome 2 at 88,958,872 bp
  • A to G, chromosome 2 at 89,977,906 bp
  • C to T, chromosome 2 at 156,078,270 bp
  • T to C, chromosome 2 at 166,059,811 bp
  • A to G, chromosome 2 at 180,687,559 bp
  • T to C, chromosome 3 at 87,971,795 bp
  • T to C, chromosome 3 at 89,072,476 bp
  • A to G, chromosome 3 at 129,718,040 bp
  • C to T, chromosome 4 at 45,342,555 bp
  • C to T, chromosome 4 at 49,323,384 bp
  • T to C, chromosome 4 at 58,821,447 bp
  • G to A, chromosome 4 at 112,118,233 bp
  • T to A, chromosome 4 at 123,472,397 bp
  • T to C, chromosome 4 at 149,331,370 bp
  • G to A, chromosome 4 at 149,627,193 bp
  • T to A, chromosome 5 at 45,582,888 bp
  • A to T, chromosome 5 at 86,081,185 bp
  • C to A, chromosome 5 at 134,558,355 bp
  • T to A, chromosome 5 at 137,438,593 bp
  • AAGAGAGAGAGAGAG to AAGAGAGAGAGAG, chromosome 6 at 34,746,173 bp
  • T to A, chromosome 6 at 73,192,422 bp
  • T to A, chromosome 6 at 86,420,400 bp
  • T to A, chromosome 6 at 106,790,971 bp
  • C to A, chromosome 6 at 115,823,649 bp
  • C to A, chromosome 6 at 122,456,283 bp
  • C to A, chromosome 6 at 129,400,134 bp
  • T to G, chromosome 6 at 146,647,459 bp
  • T to C, chromosome 7 at 16,673,485 bp
  • A to G, chromosome 7 at 24,126,974 bp
  • A to T, chromosome 7 at 45,126,818 bp
  • T to A, chromosome 7 at 62,348,822 bp
  • T to A, chromosome 7 at 80,875,402 bp
  • G to A, chromosome 7 at 92,659,777 bp
  • T to G, chromosome 7 at 103,551,976 bp
  • T to A, chromosome 7 at 104,618,424 bp
  • T to C, chromosome 7 at 108,423,102 bp
  • T to A, chromosome 7 at 130,624,861 bp
  • A to G, chromosome 7 at 141,463,538 bp
  • T to A, chromosome 8 at 3,521,412 bp
  • G to A, chromosome 8 at 110,844,505 bp
  • T to G, chromosome 8 at 124,374,481 bp
  • A to T, chromosome 9 at 13,252,635 bp
  • T to C, chromosome 9 at 56,898,205 bp
  • A to T, chromosome 9 at 60,854,429 bp
  • A to G, chromosome 9 at 86,792,017 bp
  • T to C, chromosome 10 at 17,915,309 bp
  • A to T, chromosome 10 at 33,948,984 bp
  • A to G, chromosome 10 at 62,838,848 bp
  • A to G, chromosome 10 at 79,965,235 bp
  • A to G, chromosome 10 at 82,059,980 bp
  • T to G, chromosome 11 at 77,893,770 bp
  • T to C, chromosome 11 at 101,417,059 bp
  • T to C, chromosome 11 at 105,867,480 bp
  • T to A, chromosome 11 at 119,029,109 bp
  • A to G, chromosome 12 at 34,373,960 bp
  • T to A, chromosome 12 at 95,780,688 bp
  • T to C, chromosome 12 at 108,358,086 bp
  • T to C, chromosome 13 at 3,573,686 bp
  • A to C, chromosome 13 at 56,083,184 bp
  • A to T, chromosome 13 at 100,444,174 bp
  • T to C, chromosome 13 at 120,240,826 bp
  • TCAACAACAACAACAACAACAACAACAACAA to TCAACAACAACAACAACAACAACAACAA, chromosome 14 at 26,396,561 bp
  • A to T, chromosome 14 at 52,581,003 bp
  • C to A, chromosome 15 at 90,940,545 bp
  • T to C, chromosome 15 at 101,203,058 bp
  • T to C, chromosome 15 at 101,802,075 bp
  • A to G, chromosome 16 at 15,887,521 bp
  • T to A, chromosome 17 at 18,304,993 bp
  • A to G, chromosome 17 at 28,745,022 bp
  • T to A, chromosome 17 at 35,885,939 bp
  • A to G, chromosome 17 at 45,589,575 bp
  • A to T, chromosome 18 at 22,517,738 bp
  • T to A, chromosome 19 at 13,313,814 bp
  • T to C, chromosome 19 at 37,609,082 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4674 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041929-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.