Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4674Btlr/Mmmh
Stock Number:
041929-MU
Citation ID:
RRID:MMRRC_041929-MU
Other Names:
R4674 (G1), C57BL/6J-MtgxR4674Btlr
Major Collection:

Strain Information

Rpl13a
Name: ribosomal protein L13A
Synonyms: tum-antigen, tum-transplantation antigen P198, Tstap198-7, 1810026N22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22121
Homologene: 111053
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: pCIP, TRAM-1, AIB1, RAC3, TRAM1, Src3, 2010305B15Rik, KAT13B, bHLHe42
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,606,620 bp
  • T to C, chromosome 1 at 118,836,029 bp
  • T to A, chromosome 1 at 127,390,758 bp
  • A to G, chromosome 1 at 132,463,390 bp
  • A to G, chromosome 1 at 139,501,804 bp
  • A to C, chromosome 1 at 156,277,435 bp
  • A to T, chromosome 1 at 171,873,320 bp
  • A to T, chromosome 1 at 172,257,656 bp
  • G to A, chromosome 1 at 172,318,912 bp
  • A to G, chromosome 1 at 180,994,691 bp
  • T to C, chromosome 2 at 25,052,317 bp
  • C to T, chromosome 2 at 31,454,812 bp
  • T to A, chromosome 2 at 52,106,942 bp
  • G to T, chromosome 2 at 88,958,872 bp
  • A to G, chromosome 2 at 89,977,906 bp
  • C to T, chromosome 2 at 156,078,270 bp
  • T to C, chromosome 2 at 166,059,811 bp
  • A to G, chromosome 2 at 180,687,559 bp
  • T to C, chromosome 3 at 87,971,795 bp
  • T to C, chromosome 3 at 89,072,476 bp
  • A to G, chromosome 3 at 129,718,040 bp
  • C to T, chromosome 4 at 45,342,555 bp
  • C to T, chromosome 4 at 49,323,384 bp
  • T to C, chromosome 4 at 58,821,447 bp
  • G to A, chromosome 4 at 112,118,233 bp
  • T to A, chromosome 4 at 123,472,397 bp
  • T to C, chromosome 4 at 149,331,370 bp
  • G to A, chromosome 4 at 149,627,193 bp
  • T to A, chromosome 5 at 45,582,888 bp
  • A to T, chromosome 5 at 86,081,185 bp
  • C to A, chromosome 5 at 134,558,355 bp
  • T to A, chromosome 5 at 137,438,593 bp
  • AAGAGAGAGAGAGAG to AAGAGAGAGAGAG, chromosome 6 at 34,746,173 bp
  • T to A, chromosome 6 at 73,192,422 bp
  • T to A, chromosome 6 at 86,420,400 bp
  • T to A, chromosome 6 at 106,790,971 bp
  • C to A, chromosome 6 at 115,823,649 bp
  • C to A, chromosome 6 at 122,456,283 bp
  • C to A, chromosome 6 at 129,400,134 bp
  • T to G, chromosome 6 at 146,647,459 bp
  • T to C, chromosome 7 at 16,673,485 bp
  • A to G, chromosome 7 at 24,126,974 bp
  • A to T, chromosome 7 at 45,126,818 bp
  • T to A, chromosome 7 at 62,348,822 bp
  • T to A, chromosome 7 at 80,875,402 bp
  • G to A, chromosome 7 at 92,659,777 bp
  • T to G, chromosome 7 at 103,551,976 bp
  • T to A, chromosome 7 at 104,618,424 bp
  • T to C, chromosome 7 at 108,423,102 bp
  • T to A, chromosome 7 at 130,624,861 bp
  • A to G, chromosome 7 at 141,463,538 bp
  • T to A, chromosome 8 at 3,521,412 bp
  • G to A, chromosome 8 at 110,844,505 bp
  • T to G, chromosome 8 at 124,374,481 bp
  • A to T, chromosome 9 at 13,252,635 bp
  • T to C, chromosome 9 at 56,898,205 bp
  • A to T, chromosome 9 at 60,854,429 bp
  • A to G, chromosome 9 at 86,792,017 bp
  • T to C, chromosome 10 at 17,915,309 bp
  • A to T, chromosome 10 at 33,948,984 bp
  • A to G, chromosome 10 at 62,838,848 bp
  • A to G, chromosome 10 at 79,965,235 bp
  • A to G, chromosome 10 at 82,059,980 bp
  • T to G, chromosome 11 at 77,893,770 bp
  • T to C, chromosome 11 at 101,417,059 bp
  • T to C, chromosome 11 at 105,867,480 bp
  • T to A, chromosome 11 at 119,029,109 bp
  • A to G, chromosome 12 at 34,373,960 bp
  • T to A, chromosome 12 at 95,780,688 bp
  • T to C, chromosome 12 at 108,358,086 bp
  • T to C, chromosome 13 at 3,573,686 bp
  • A to C, chromosome 13 at 56,083,184 bp
  • A to T, chromosome 13 at 100,444,174 bp
  • T to C, chromosome 13 at 120,240,826 bp
  • TCAACAACAACAACAACAACAACAACAACAA to TCAACAACAACAACAACAACAACAACAA, chromosome 14 at 26,396,561 bp
  • A to T, chromosome 14 at 52,581,003 bp
  • C to A, chromosome 15 at 90,940,545 bp
  • T to C, chromosome 15 at 101,203,058 bp
  • T to C, chromosome 15 at 101,802,075 bp
  • A to G, chromosome 16 at 15,887,521 bp
  • T to A, chromosome 17 at 18,304,993 bp
  • A to G, chromosome 17 at 28,745,022 bp
  • T to A, chromosome 17 at 35,885,939 bp
  • A to G, chromosome 17 at 45,589,575 bp
  • A to T, chromosome 18 at 22,517,738 bp
  • T to A, chromosome 19 at 13,313,814 bp
  • T to C, chromosome 19 at 37,609,082 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4674 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041929-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.