Strain Name:
C57BL/6J-MtgxR4680Btlr/Mmmh
Stock Number:
041933-MU
Citation ID:
RRID:MMRRC_041933-MU
Other Names:
R4680 (G1), C57BL/6J-MtgxR4680Btlr
Major Collection:

Strain Information

Sncg
Name: synuclein, gamma
Synonyms: persyn, C79089
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20618
Homologene: 2322
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Sigmar1
Name: sigma non-opioid intracellular receptor 1
Synonyms: Sig1R, Oprs1, mSigmaR1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18391
HGNC: HGNC:8157
Homologene: 39965
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: slip, DNAPDcs, DNA-PKcs, DNA-PK, DOXNPH, XRCC7, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Gpr26
Name: G protein-coupled receptor 26
Synonyms: 9630036A11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233919
HGNC: HGNC:4481
Homologene: 17764
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53625
Homologene: 4797
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: 3010002K18Rik, Qprs, 2410081F06Rik, Eprs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: protein phosphatase 2A subunit beta, B56beta, 4633401M22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Kdm2b
Name: lysine (K)-specific demethylase 2B
Synonyms: Fbxl10, Cxxc2, Jhdm1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 30841
Homologene: 13069
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, MCPH5, D330028K02Rik, Aspm, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Gtf2ird1
Name: general transcription factor II I repeat domain-containing 1
Synonyms: binding factor for early enhancer, ESTM9, Cream1, MusTRD1, GTF3, WBSCR11, BEN
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57080
HGNC: HGNC:4661
Homologene: 4158
Rlig1
Name: RNA 5'-phosphate and 3'-OH ligase 1
Synonyms: 4930430F08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68281
VEGA: 10
Homologene: 18409
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: 2610036I19Rik, Acinus, 2610510L13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56215
Homologene: 22853
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, CD148, Scc1, DEP-1, Scc-1, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Msantd2
Name: Myb/SANT-like DNA-binding domain containing 2
Synonyms: 2810450G17Rik, BC024479, 9530092B10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235184
Homologene: 36421
Rbm48
Name: RNA binding motif protein 48
Synonyms: C030048B08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269623
Homologene: 12944
Ropn1
Name: ropporin, rhophilin associated protein 1
Synonyms: RHPNAP1, ODF6, 1700008N21Rik, ropporin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 76378
Homologene: 57119
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Rab11fip2
Name: RAB11 family interacting protein 2 (class I)
Synonyms: nRip11, Rab11-FIP2, 4930470G04Rik, A830046J09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74998
Homologene: 8937
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Or8h9
Name: olfactory receptor family 8 subfamily H member 9
Synonyms: Olfr1099, GA_x6K02T2Q125-48446067-48445129, MOR206-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258764
Homologene: 107003
Uqcrc1
Name: ubiquinol-cytochrome c reductase core protein 1
Synonyms: 1110032G10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22273
Homologene: 2525
Nid1
Name: nidogen 1
Synonyms: entactin 1, entactin-1, entactin, nidogen-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
4921509C19Rik
Name: RIKEN cDNA 4921509C19 gene
Synonyms: LOC381389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381393
Homologene: 72396
Traf3ip2
Name: TRAF3 interacting protein 2
Synonyms: Act1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103213
HGNC: HGNC:1343
Homologene: 15885
Gm4540
Name: predicted gene 4540
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 100043594
Obox1
Name: oocyte specific homeobox 1
Synonyms: 7420700M11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71468
Homologene: 44937
Or14j7
Name: olfactory receptor family 14 subfamily J member 7
Synonyms: Olfr128, GA_x6K02T2PSCP-2374126-2375048, MOR218-13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383243
Homologene: 134080
Acadsb
Name: acyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms: 1300003O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66885
HGNC: HGNC:91
Homologene: 1216
4931414P19Rik
Name: RIKEN cDNA 4931414P19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74359
VEGA: 14
Homologene: 11078
Rwdd2b
Name: RWD domain containing 2B
Synonyms: ORF5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 53858
HGNC: HGNC:1302
Homologene: 9654
Ltb4r1
Name: leukotriene B4 receptor 1
Synonyms: BLTR, BLT1, mBLTR
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16995
HGNC: HGNC:6713
Homologene: 22477
Or8k20
Name: olfactory receptor family 8 subfamily K member 20
Synonyms: MOR187-5, Olfr1051, GA_x6K02T2Q125-47756192-47755266
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404324
Homologene: 77387
Lipi
Name: lipase, member I
Synonyms: lpd1, D930038D03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320355
Homologene: 77864
Kat2b-ps
Name: K(lysine) acetyltransferase 2B, pseudogene
Synonyms: P/CAF pseudogene, Pcaf-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100504388
Gm27421
Name: predicted gene, 27421
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 139,480,671 bp
  • T to C, chromosome 1 at 185,386,278 bp
  • A to T, chromosome 2 at 73,828,681 bp
  • C to T, chromosome 2 at 76,932,677 bp
  • T to A, chromosome 2 at 86,276,173 bp
  • T to C, chromosome 2 at 86,959,321 bp
  • T to C, chromosome 2 at 90,460,496 bp
  • A to T, chromosome 2 at 151,473,470 bp
  • A to G, chromosome 3 at 106,034,875 bp
  • A to G, chromosome 4 at 41,741,251 bp
  • CTTCCAGAGCCATGGACCCATCTTTTCCA to CTTCCA, chromosome 4 at 134,072,718 bp
  • G to A, chromosome 4 at 142,011,547 bp
  • A to C, chromosome 4 at 145,108,510 bp
  • G to A, chromosome 5 at 3,591,755 bp
  • A to G, chromosome 5 at 93,391,440 bp
  • A to T, chromosome 5 at 122,934,786 bp
  • T to A, chromosome 5 at 134,357,881 bp
  • C to A, chromosome 6 at 84,097,715 bp
  • A to T, chromosome 7 at 15,556,164 bp
  • T to C, chromosome 7 at 131,432,026 bp
  • A to G, chromosome 7 at 131,974,353 bp
  • A to G, chromosome 9 at 37,523,091 bp
  • G to A, chromosome 9 at 108,947,861 bp
  • C to T, chromosome 10 at 39,639,260 bp
  • T to C, chromosome 10 at 100,578,381 bp
  • A to G, chromosome 11 at 22,837,105 bp
  • C to T, chromosome 12 at 75,469,759 bp
  • A to T, chromosome 13 at 11,595,233 bp
  • G to A, chromosome 13 at 13,472,852 bp
  • T to A, chromosome 14 at 34,373,311 bp
  • T to C, chromosome 14 at 54,585,076 bp
  • T to C, chromosome 14 at 54,686,758 bp
  • T to C, chromosome 14 at 55,767,468 bp
  • A to T, chromosome 15 at 73,533,376 bp
  • T to C, chromosome 15 at 76,180,575 bp
  • A to G, chromosome 16 at 15,772,030 bp
  • A to G, chromosome 16 at 34,677,305 bp
  • A to G, chromosome 16 at 75,565,529 bp
  • A to G, chromosome 16 at 87,437,062 bp
  • T to C, chromosome 17 at 37,923,922 bp
  • T to C, chromosome 19 at 59,936,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4680 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041933-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.