Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4725Btlr/Mmmh
Stock Number:
041960-MU
Citation ID:
RRID:MMRRC_041960-MU
Other Names:
R4725 (G1), C57BL/6J-MtgxR4725Btlr
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Kcnj10
Name: potassium inwardly-rectifying channel, subfamily J, member 10
Synonyms: Kir1.2, BIRK-1, BIR10, Kir4.1, Kir4.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16513
HGNC: HGNC:6256
Homologene: 1689
Ubn2
Name: ubinuclein 2
Synonyms: 6030408G03Rik, 2900060J04Rik, D130059P03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320538
Homologene: 45564
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 74,394,664 bp
  • T to A, chromosome 1 at 78,967,832 bp
  • C to T, chromosome 1 at 106,982,844 bp
  • C to A, chromosome 1 at 133,283,320 bp
  • T to A, chromosome 1 at 172,369,159 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to C, chromosome 2 at 34,795,308 bp
  • T to C, chromosome 2 at 120,435,273 bp
  • C to G, chromosome 2 at 121,139,430 bp
  • T to C, chromosome 2 at 127,431,982 bp
  • A to G, chromosome 3 at 89,091,429 bp
  • GAAGTTGTTTGGAGATTCTTATCTTA to GA, chromosome 3 at 158,318,408 bp
  • A to G, chromosome 4 at 44,066,806 bp
  • G to A, chromosome 4 at 45,372,769 bp
  • A to G, chromosome 4 at 102,966,222 bp
  • T to C, chromosome 4 at 132,745,178 bp
  • A to G, chromosome 4 at 137,018,761 bp
  • G to A, chromosome 4 at 141,639,806 bp
  • A to T, chromosome 4 at 141,928,378 bp
  • A to G, chromosome 4 at 151,148,496 bp
  • A to G, chromosome 5 at 5,508,385 bp
  • T to C, chromosome 5 at 21,910,952 bp
  • T to C, chromosome 5 at 81,766,205 bp
  • T to C, chromosome 5 at 84,233,917 bp
  • G to T, chromosome 5 at 114,065,485 bp
  • T to C, chromosome 5 at 137,295,307 bp
  • A to G, chromosome 6 at 38,522,305 bp
  • A to G, chromosome 6 at 41,135,398 bp
  • A to C, chromosome 6 at 68,220,466 bp
  • A to T, chromosome 6 at 84,097,756 bp
  • A to G, chromosome 6 at 149,044,779 bp
  • A to C, chromosome 7 at 3,821,548 bp
  • T to C, chromosome 7 at 17,760,677 bp
  • G to T, chromosome 7 at 34,251,059 bp
  • T to C, chromosome 7 at 105,755,253 bp
  • C to G, chromosome 7 at 105,765,552 bp
  • C to A, chromosome 7 at 113,304,359 bp
  • T to A, chromosome 7 at 134,745,014 bp
  • A to G, chromosome 8 at 84,929,006 bp
  • G to A, chromosome 9 at 21,348,395 bp
  • T to C, chromosome 9 at 102,590,556 bp
  • T to C, chromosome 9 at 120,577,703 bp
  • T to A, chromosome 10 at 87,554,376 bp
  • A to T, chromosome 11 at 6,193,475 bp
  • T to A, chromosome 11 at 29,708,362 bp
  • A to G, chromosome 11 at 61,791,486 bp
  • A to G, chromosome 11 at 69,330,468 bp
  • A to G, chromosome 11 at 70,800,713 bp
  • A to G, chromosome 11 at 98,425,144 bp
  • A to T, chromosome 12 at 32,193,597 bp
  • A to G, chromosome 12 at 52,024,109 bp
  • C to T, chromosome 13 at 12,424,662 bp
  • A to G, chromosome 13 at 42,163,411 bp
  • T to A, chromosome 14 at 73,568,989 bp
  • A to G, chromosome 15 at 74,616,107 bp
  • T to C, chromosome 15 at 94,351,762 bp
  • A to T, chromosome 16 at 16,792,531 bp
  • G to T, chromosome 16 at 43,822,801 bp
  • A to T, chromosome 16 at 75,945,329 bp
  • A to T, chromosome 17 at 34,699,067 bp
  • A to C, chromosome 18 at 67,816,766 bp
  • T to A, chromosome 18 at 77,395,457 bp
  • C to T, chromosome 19 at 6,857,113 bp
  • T to A, chromosome 19 at 20,640,081 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4725 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041960-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.