Strain Name:
C57BL/6J-MtgxR4751Btlr/Mmmh
Stock Number:
041970-MU
Citation ID:
RRID:MMRRC_041970-MU
Other Names:
R4751 (G1), C57BL/6J-MtgxR4751Btlr
Major Collection:

Gene Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 24069
Homologene: 9262
Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218035
VEGA: 13
Homologene: 69165
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269132
Homologene: 22865
Icos
Name: inducible T cell co-stimulator
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 54167
HGNC: HGNC:5351
Homologene: 8097
Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 21752
VEGA: 13
Homologene: 31141
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Dst
Name: dystonin
Synonyms: A830042E19Rik, 2310001O04Rik, Macf2, bullous pemphigoid antigen 1, BPAG1-n, BPAG1, athetoid, Bpag, ah, bullous pemphigoid antigen 1, Bpag1, nmf339, nmf203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 11426
Homologene: 136191
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: TRAM-1, Src3, pCIP, KAT13B, bHLHe42, RAC3, 2010305B15Rik, AIB1, TRAM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: PARP-7, DDF1, PARP7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99929
Homologene: 9167
Dnajc11
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230935
Homologene: 14558
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 217692
VEGA: 12
Homologene: 9189
Tpgs1
Name: tubulin polyglutamylase complex subunit 1
Synonyms: Gm16517, Gtrgeo22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 110012
VEGA: 10
Homologene: 17525
Pipox
Name: pipecolic acid oxidase
Synonyms: Pso
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 19193
Homologene: 40640
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 15184
Homologene: 3995
Lmna
Name: lamin A
Synonyms: lamin A/C, Dhe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 16905
HGNC: HGNC:6636
Homologene: 41321
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 27223
Homologene: 4137
Mgll
Name: monoglyceride lipase
Synonyms: Magl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 23945
Homologene: 38298
Hspa4
Name: heat shock protein 4
Synonyms: Hsp110, 70kDa, Hsp70RY, APG-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Shroom3
Name: shroom family member 3
Synonyms: Shrm3, Shrm, D5Ertd287e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 27428
Homologene: 9263
Kpna2
Name: karyopherin (importin) alpha 2
Synonyms: Importin alpha, m-importin, 2410044B12Rik, importin alpha 1, Rch1, pendulin, m-importin-alpha-P1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16647
HGNC: HGNC:6395
Homologene: 1708
Arfgap2
Name: ADP-ribosylation factor GTPase activating protein 2
Synonyms: Zfp289, 2310032E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 77038
Homologene: 8735
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237859
Homologene: 134095
Spcs2
Name: signal peptidase complex subunit 2 homolog (S. cerevisiae)
Synonyms: 5730406I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 66624
Homologene: 8842
Mrpl47
Name: mitochondrial ribosomal protein L47
Synonyms: CGI-204, 4833424P18Rik, NCM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74600
Homologene: 32475
Smchd1
Name: SMC hinge domain containing 1
Synonyms: MommeD1, 4931400A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 74355
Homologene: 23665
Cast
Name: calpastatin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 12380
VEGA: 13
HGNC: HGNC:1515
Homologene: 7658
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Tbc1d15
Name: TBC1 domain family, member 15
Synonyms: 4432405K22Rik, Ly6dl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 66687
VEGA: 10
Homologene: 11249
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, AnkG, Ankyrin-G, Ankyrin-3, 2900054D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Slc44a1
Name: solute carrier family 44, member 1
Synonyms: Cdw92, 2210409B22Rik, CTL1, CHTL1, 4833416H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100434
Homologene: 11137
Clpb
Name: ClpB caseinolytic peptidase B
Synonyms: Skd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20480
Homologene: 32067
Abr
Name: active BCR-related gene
Synonyms: 6330400K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 109934
HGNC: HGNC:81
Homologene: 11081
Brat1
Name: BRCA1-associated ATM activator 1
Synonyms: Baat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231841
Homologene: 16776
Aftph
Name: aftiphilin
Synonyms: 9130023F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216549
Homologene: 9764
Eif4g1
Name: eukaryotic translation initiation factor 4, gamma 1
Synonyms: E030015G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 208643
HGNC: HGNC:3296
Homologene: 110725
Lman1
Name: lectin, mannose-binding, 1
Synonyms: MCFD1, P58, gp58, ERGIC53, MR60, F5F8D, 2610020P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 70361
HGNC: HGNC:6631
Homologene: 4070
Sptb
Name: spectrin beta, erythrocytic
Synonyms: spectrin R, brain erythroid spectrin (235E), LOC383567, Spnb-1, Spnb1, D330027P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 20741
Homologene: 295
Lrp10
Name: low-density lipoprotein receptor-related protein 10
Synonyms: Lrp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 65107
VEGA: 14
Homologene: 8535
Homer3
Name: homer scaffolding protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 26558
Homologene: 37972
Cntrl
Name: centriolin
Synonyms: b2b1468Clo, 6720467O09Rik, IB3/5, Cep110, Cep1, Ma2a8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Riok3
Name: RIO kinase 3
Synonyms: D18Ertd331e, Sudd, E130306C24Rik, 1200013N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 66878
VEGA: 18
Homologene: 2843
Zfp507
Name: zinc finger protein 507
Synonyms: 1810022O10Rik, A230056M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 668501
Homologene: 8942
Tsc1
Name: TSC complex subunit 1
Synonyms: tuberous sclerosis 1, hamartin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 64930
Homologene: 314
AU040320
Name: expressed sequence AU040320
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100317
Homologene: 11764
Ptgs2
Name: prostaglandin-endoperoxide synthase 2
Synonyms: PGHS-2, cyclooxygenase-2, Pghs2, PHS-2, COX2, Tis10, prostaglandin G/H synthase, cyclooxygenase 2, Cox-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19225
HGNC: HGNC:9605
Homologene: 31000
Clec4f
Name: C-type lectin domain family 4, member f
Synonyms: kupffer cell receptor, Clecsf13, D18063
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 51811
Homologene: 9630
Stum
Name: mechanosensory transduction mediator
Synonyms: 6330403A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381310
Homologene: 36008
Dhodh
Name: dihydroorotate dehydrogenase
Synonyms: 2810417D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 56749
HGNC: HGNC:2867
Homologene: 1043
Fbxo33
Name: F-box protein 33
Synonyms: 5730501N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 70611
Homologene: 16501
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268379
Homologene: 27991
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Elane
Name: elastase, neutrophil expressed
Synonyms: F430011M15Rik, NE, Ela2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 50701
VEGA: 10
HGNC: HGNC:3309
Homologene: 20455
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 78923
VEGA: 18
Homologene: 28624
Ush2a
Name: usherin
Synonyms: Ush2a, Ushrn, MUSH2A, A930037M10Rik, A930011D15Rik, LOC269160, LOC381317
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22283
Homologene: 66151
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 672511
Homologene: 45439
Uba7
Name: ubiquitin-like modifier activating enzyme 7
Synonyms: 1300004C08Rik, Ube1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74153
Homologene: 2502
Fbxo30
Name: F-box protein 30
Synonyms: 1700026A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 71865
Homologene: 12959
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 211223
Homologene: 129606
Krt71
Name: keratin 71
Synonyms: Cu, Krt2-6g, mK6irs1, Cal4, Ca, mK6irs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 56735
Homologene: 88864
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235505
Homologene: 25183
Abca9
Name: ATP-binding cassette, sub-family A (ABC1), member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Otoa
Name: otoancorin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 246190
Homologene: 71803
Fetub
Name: fetuin beta
Synonyms: 2310011O17Rik, D17980
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 59083
VEGA: 16
HGNC: HGNC:3658
Homologene: 8660
Wnk4
Name: WNK lysine deficient protein kinase 4
Synonyms: Prkwnk4, 2010002J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69847
Homologene: 13020
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 210274
Homologene: 105965
Vars2
Name: valyl-tRNA synthetase 2, mitochondrial
Synonyms: 1190004I24Rik, Vars2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 68915
Homologene: 57502
Mrpl37
Name: mitochondrial ribosomal protein L37
Synonyms: 2300004O14Rik, MRP-L2, Rpml2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56280
Homologene: 9536
Bcl9l
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 80288
VEGA: 9
Homologene: 65615
Rhoc
Name: ras homolog family member C
Synonyms: Arh9, Arhc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 11853
HGNC: HGNC:669
Homologene: 90945
Abca14
Name: ATP-binding cassette, sub-family A (ABC1), member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 67928
Homologene: 86128
Obox3
Name: oocyte specific homeobox 3
Synonyms: Ohx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 246791
Homologene: 44937
Mylk
Name: myosin, light polypeptide kinase
Synonyms: MLCK108, A930019C19Rik, Mlck, nmMlck, telokin, MLCK210, 9530072E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Clnk
Name: cytokine-dependent hematopoietic cell linker
Synonyms: MIST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 27278
Homologene: 8450
Nme8
Name: NME/NM23 family member 8
Synonyms: 1700056P15Rik, Sptrx-2, Txndc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 73412
Homologene: 9593
Ncf1
Name: neutrophil cytosolic factor 1
Synonyms: NADPH oxidase subunit (47kDa), p47phox, Ncf-1, NOXO2, p47phox
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 17969
HGNC: HGNC:7660
Homologene: 30964
Vgf
Name: VGF nerve growth factor inducible
Synonyms: LOC381677
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381677
Homologene: 2536
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
B3glct
Name: beta-3-glucosyltransferase
Synonyms: B3galtl, LOC381694
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381694
Homologene: 14978
Olfr1211
Name: olfactory receptor 1211
Synonyms: MOR233-16P, GA_x6K02T2Q125-50409367-50408432, MOR233-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258025
Homologene: 81548
Osbpl3
Name: oxysterol binding protein-like 3
Synonyms: 1200014M06Rik, 6720421I08Rik, ORP3, OSBP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 71720
Homologene: 49422
Rasgrf1
Name: RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms: Grfbeta, Grf1, CDC25, CDC25Mm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 19417
HGNC: HGNC:9875
Homologene: 74972
Krtap31-2
Name: keratin associated protein 31-2
Synonyms: OTTMUSG00000002177
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 432602
Homologene: 134336
Slc22a19
Name: solute carrier family 22 (organic anion transporter), member 19
Synonyms: D630043A20Rik, Slc22a9, Oat5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 207151
Homologene: 133125
Pck2
Name: phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms: 1810010O14Rik, 9130022B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 74551
VEGA: 14
HGNC: HGNC:8725
Homologene: 3356
Zfp956
Name: zinc finger protein 956
Synonyms: AI894139
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 101197
Homologene: 128449
Ptpru
Name: protein tyrosine phosphatase, receptor type, U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Slc22a20
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: mOAT6, LOC381203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 381203
Homologene: 87203
Ino80b
Name: INO80 complex subunit B
Synonyms: Papa1, HMG1YL4, 2510009I23Rik, Znhit4, Hmga1l4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 70020
Homologene: 32566
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: activated p21cdc42Hs kinase, ACK1, P21cdc42Hs kinase, Pyk1, Ack
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 51789
Homologene: 4224
9130023H24Rik
Name: RIKEN cDNA 9130023H24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100043133
Nacad
Name: NAC alpha domain containing
Synonyms: mKIAA0363
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 192950
Homologene: 135717
St8sia4
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Synonyms: PST, ST8SiaIV, Siat8d, PST-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20452
Homologene: 4147
Qrfpr
Name: pyroglutamylated RFamide peptide receptor
Synonyms: Gpr103, AQ27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229214
Homologene: 18865
Sun5
Name: Sad1 and UNC84 domain containing 5
Synonyms: Spag4l, 1700021O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 76407
Homologene: 12640
Necab2
Name: N-terminal EF-hand calcium binding protein 2
Synonyms: Necab2, Efcbp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 117148
Homologene: 62200
Tuba4a
Name: tubulin, alpha 4A
Synonyms: M[a]4, Tuba4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22145
Homologene: 68496
Olfr667
Name: olfactory receptor 667
Synonyms: MOR34-11, MOR34-2, GA_x6K02T2PBJ9-7546146-7545166
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 259062
Homologene: 121559
Olfr355
Name: olfactory receptor 355
Synonyms: GA_x6K02T2NLDC-33622642-33621710, MOR138-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258618
Homologene: 132326
Asphd2
Name: aspartate beta-hydroxylase domain containing 2
Synonyms: 2900006N09Rik, 9230106G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 72898
Homologene: 10717
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 105387
Homologene: 138093
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Olfr1428
Name: olfactory receptor 1428
Synonyms: GA_x6K02T2RE5P-2468394-2467450, MOR239-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258673
Homologene: 17339
Gpx6
Name: glutathione peroxidase 6
Synonyms: olfactory, 1700020G18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 75512
HGNC: HGNC:4558
Homologene: 130008
Gm20628
Name: predicted gene 20628
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
Gm5861
Name: predicted gene 5861
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 545728
Olfr1416
Name: olfactory receptor 1416
Synonyms: MOR103-3, GA_x6K02T2R7CC-81277975-81278913
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 259040
Homologene: 17472
Med24
Name: mediator complex subunit 24
Synonyms: 100kDa, D11Ertd307e, DRIP100, Thrap4, R75526, Pparb2, Gse2, Trap100
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 23989
Homologene: 40795
Cyp2e1
Name: cytochrome P450, family 2, subfamily e, polypeptide 1
Synonyms: Cyp2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 13106
HGNC: HGNC:2631
Homologene: 68089
Ifna4
Name: interferon alpha 4
Synonyms: Ifa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 15967
Carns1
Name: carnosine synthase 1
Synonyms: Atpgd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 107239
VEGA: 19
Homologene: 26439
Zfp768
Name: zinc finger protein 768
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233890
Homologene: 11650
Vta1
Name: vesicle (multivesicular body) trafficking 1
Synonyms: 1110059P08Rik, 1110001D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 66201
Homologene: 6473
Btbd18
Name: BTB (POZ) domain containing 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 100270744
Homologene: 122125
Gm13762
Name: predicted gene 13762
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
Pcdha10
Name: protocadherin alpha 10
Synonyms: Crnr3, Cnr8, Crnr8, Pcdha14, Cnr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 12943
VEGA: 18
HGNC: HGNC:8666
Homologene: 135720
Aspdh
Name: aspartate dehydrogenase domain containing
Synonyms: 0610012D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 68352
Homologene: 41692
Pagr1b
Name: PAXIP1 associated glutamate rich protein 1B
Synonyms: Gm20418
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
Ppif
Name: peptidylprolyl isomerase F (cyclophilin F)
Synonyms: CyP-D, mitochondrial Cyclophilin D, CypD, CyP-F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 105675
HGNC: HGNC:9259
Homologene: 38696
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,191,884 bp
  • C to T, chromosome 1 at 60,993,717 bp
  • T to C, chromosome 1 at 75,216,561 bp
  • C to A, chromosome 1 at 92,479,983 bp
  • C to T, chromosome 1 at 95,660,983 bp
  • T to A, chromosome 1 at 150,104,020 bp
  • T to A, chromosome 1 at 152,489,876 bp
  • T to C, chromosome 1 at 180,442,669 bp
  • T to A, chromosome 1 at 188,850,087 bp
  • G to T, chromosome 2 at 13,544,653 bp
  • T to A, chromosome 2 at 28,679,081 bp
  • C to A, chromosome 2 at 35,162,841 bp
  • T to C, chromosome 2 at 36,927,583 bp
  • T to C, chromosome 2 at 76,709,605 bp
  • T to C, chromosome 2 at 76,897,581 bp
  • T to A, chromosome 2 at 84,667,921 bp
  • T to A, chromosome 2 at 88,929,914 bp
  • A to G, chromosome 2 at 88,973,133 bp
  • T to G, chromosome 2 at 91,267,368 bp
  • T to A, chromosome 2 at 121,227,809 bp
  • T to A, chromosome 2 at 127,823,938 bp
  • T to C, chromosome 2 at 153,866,016 bp
  • T to A, chromosome 2 at 166,069,903 bp
  • C to T, chromosome 3 at 32,728,441 bp
  • T to C, chromosome 3 at 36,182,622 bp
  • T to C, chromosome 3 at 65,552,804 bp
  • T to C, chromosome 3 at 88,486,533 bp
  • A to T, chromosome 3 at 96,269,151 bp
  • T to A, chromosome 3 at 104,792,647 bp
  • A to T, chromosome 3 at 145,004,848 bp
  • A to T, chromosome 4 at 53,560,973 bp
  • A to G, chromosome 4 at 88,841,948 bp
  • A to T, chromosome 4 at 107,057,475 bp
  • A to C, chromosome 4 at 123,471,650 bp
  • G to A, chromosome 4 at 126,854,466 bp
  • A to G, chromosome 4 at 131,802,586 bp
  • G to A, chromosome 4 at 151,968,542 bp
  • T to A, chromosome 5 at 11,186,491 bp
  • T to C, chromosome 5 at 38,720,913 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • T to C, chromosome 5 at 109,286,754 bp
  • C to A, chromosome 5 at 112,391,746 bp
  • T to A, chromosome 5 at 134,229,545 bp
  • T to A, chromosome 5 at 137,032,401 bp
  • T to G, chromosome 5 at 140,718,296 bp
  • T to A, chromosome 5 at 149,725,402 bp
  • T to C, chromosome 6 at 47,963,576 bp
  • C to G, chromosome 6 at 50,300,997 bp
  • C to T, chromosome 6 at 83,124,750 bp
  • T to A, chromosome 6 at 83,645,282 bp
  • T to A, chromosome 6 at 88,725,111 bp
  • A to T, chromosome 7 at 15,625,692 bp
  • T to C, chromosome 7 at 35,794,382 bp
  • T to A, chromosome 7 at 44,467,205 bp
  • A to T, chromosome 7 at 99,844,769 bp
  • G to A, chromosome 7 at 101,786,110 bp
  • A to T, chromosome 7 at 104,916,410 bp
  • A to G, chromosome 7 at 120,312,177 bp
  • T to C, chromosome 7 at 121,132,924 bp
  • A to T, chromosome 7 at 127,015,379 bp
  • A to G, chromosome 7 at 127,344,762 bp
  • A to T, chromosome 7 at 128,237,086 bp
  • A to T, chromosome 7 at 140,774,716 bp
  • T to C, chromosome 7 at 141,817,601 bp
  • C to T, chromosome 7 at 144,409,468 bp
  • A to T, chromosome 8 at 70,285,434 bp
  • A to G, chromosome 8 at 109,596,153 bp
  • C to T, chromosome 8 at 119,467,598 bp
  • A to G, chromosome 9 at 44,506,803 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 89,910,118 bp
  • A to G, chromosome 9 at 90,012,866 bp
  • T to A, chromosome 9 at 107,979,805 bp
  • T to A, chromosome 10 at 11,290,195 bp
  • C to T, chromosome 10 at 14,655,816 bp
  • C to T, chromosome 10 at 69,986,206 bp
  • T to C, chromosome 10 at 79,675,620 bp
  • A to G, chromosome 10 at 79,886,791 bp
  • T to A, chromosome 10 at 115,202,587 bp
  • A to G, chromosome 11 at 6,605,726 bp
  • G to A, chromosome 11 at 9,277,973 bp
  • A to C, chromosome 11 at 20,727,074 bp
  • C to T, chromosome 11 at 53,284,199 bp
  • T to C, chromosome 11 at 76,456,608 bp
  • T to G, chromosome 11 at 77,076,719 bp
  • C to T, chromosome 11 at 77,882,118 bp
  • A to G, chromosome 11 at 98,706,432 bp
  • A to G, chromosome 11 at 99,936,576 bp
  • G to A, chromosome 11 at 101,276,362 bp
  • G to A, chromosome 11 at 102,204,504 bp
  • T to G, chromosome 11 at 106,992,664 bp
  • T to A, chromosome 11 at 110,130,570 bp
  • A to G, chromosome 11 at 119,445,745 bp
  • A to T, chromosome 12 at 59,200,928 bp
  • T to C, chromosome 12 at 76,627,110 bp
  • A to G, chromosome 12 at 82,341,194 bp
  • T to C, chromosome 13 at 4,065,338 bp
  • A to T, chromosome 13 at 18,811,622 bp
  • A to T, chromosome 13 at 19,675,638 bp
  • A to C, chromosome 13 at 21,317,064 bp
  • G to A, chromosome 13 at 73,628,063 bp
  • T to C, chromosome 13 at 74,746,047 bp
  • T to C, chromosome 14 at 25,699,499 bp
  • T to A, chromosome 14 at 54,468,592 bp
  • T to A, chromosome 14 at 55,542,561 bp
  • A to T, chromosome 15 at 6,842,852 bp
  • C to T, chromosome 15 at 101,735,466 bp
  • A to G, chromosome 16 at 20,686,515 bp
  • G to A, chromosome 16 at 22,937,895 bp
  • T to C, chromosome 16 at 32,679,857 bp
  • A to G, chromosome 16 at 34,879,169 bp
  • A to T, chromosome 17 at 35,659,343 bp
  • A to T, chromosome 17 at 71,391,468 bp
  • A to G, chromosome 18 at 12,153,983 bp
  • G to A, chromosome 18 at 37,006,944 bp
  • T to C, chromosome 18 at 59,175,800 bp
  • A to G, chromosome 18 at 65,998,434 bp
  • A to T, chromosome 19 at 4,166,418 bp
  • T to C, chromosome 19 at 5,980,460 bp
  • T to C, chromosome 19 at 7,691,145 bp
  • T to A, chromosome 19 at 10,250,394 bp
  • T to A, chromosome 19 at 12,109,177 bp
  • A to T, chromosome 19 at 46,483,649 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4751 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041970-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.