Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4751Btlr/Mmmh
Stock Number:
041970-MU
Citation ID:
RRID:MMRRC_041970-MU
Other Names:
R4751 (G1), C57BL/6J-MtgxR4751Btlr
Major Collection:

Strain Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Icos
Name: inducible T cell co-stimulator
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54167
HGNC: HGNC:5351
Homologene: 8097
Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,191,884 bp
  • C to T, chromosome 1 at 60,993,717 bp
  • T to C, chromosome 1 at 75,216,561 bp
  • C to A, chromosome 1 at 92,479,983 bp
  • C to T, chromosome 1 at 95,660,983 bp
  • T to A, chromosome 1 at 150,104,020 bp
  • T to A, chromosome 1 at 152,489,876 bp
  • T to C, chromosome 1 at 180,442,669 bp
  • T to A, chromosome 1 at 188,850,087 bp
  • G to T, chromosome 2 at 13,544,653 bp
  • T to A, chromosome 2 at 28,679,081 bp
  • C to A, chromosome 2 at 35,162,841 bp
  • T to C, chromosome 2 at 36,927,583 bp
  • T to C, chromosome 2 at 76,709,605 bp
  • T to C, chromosome 2 at 76,897,581 bp
  • T to A, chromosome 2 at 84,667,921 bp
  • T to A, chromosome 2 at 88,929,914 bp
  • A to G, chromosome 2 at 88,973,133 bp
  • T to G, chromosome 2 at 91,267,368 bp
  • T to A, chromosome 2 at 121,227,809 bp
  • T to A, chromosome 2 at 127,823,938 bp
  • T to C, chromosome 2 at 153,866,016 bp
  • T to A, chromosome 2 at 166,069,903 bp
  • C to T, chromosome 3 at 32,728,441 bp
  • T to C, chromosome 3 at 36,182,622 bp
  • T to C, chromosome 3 at 65,552,804 bp
  • T to C, chromosome 3 at 88,486,533 bp
  • A to T, chromosome 3 at 96,269,151 bp
  • T to A, chromosome 3 at 104,792,647 bp
  • A to T, chromosome 3 at 145,004,848 bp
  • A to T, chromosome 4 at 53,560,973 bp
  • A to G, chromosome 4 at 88,841,948 bp
  • A to T, chromosome 4 at 107,057,475 bp
  • A to C, chromosome 4 at 123,471,650 bp
  • G to A, chromosome 4 at 126,854,466 bp
  • A to G, chromosome 4 at 131,802,586 bp
  • G to A, chromosome 4 at 151,968,542 bp
  • T to A, chromosome 5 at 11,186,491 bp
  • T to C, chromosome 5 at 38,720,913 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • T to C, chromosome 5 at 109,286,754 bp
  • C to A, chromosome 5 at 112,391,746 bp
  • T to A, chromosome 5 at 134,229,545 bp
  • T to A, chromosome 5 at 137,032,401 bp
  • T to G, chromosome 5 at 140,718,296 bp
  • T to A, chromosome 5 at 149,725,402 bp
  • T to C, chromosome 6 at 47,963,576 bp
  • C to G, chromosome 6 at 50,300,997 bp
  • C to T, chromosome 6 at 83,124,750 bp
  • T to A, chromosome 6 at 83,645,282 bp
  • T to A, chromosome 6 at 88,725,111 bp
  • A to T, chromosome 7 at 15,625,692 bp
  • T to C, chromosome 7 at 35,794,382 bp
  • T to A, chromosome 7 at 44,467,205 bp
  • A to T, chromosome 7 at 99,844,769 bp
  • G to A, chromosome 7 at 101,786,110 bp
  • A to T, chromosome 7 at 104,916,410 bp
  • A to G, chromosome 7 at 120,312,177 bp
  • T to C, chromosome 7 at 121,132,924 bp
  • A to T, chromosome 7 at 127,015,379 bp
  • A to G, chromosome 7 at 127,344,762 bp
  • A to T, chromosome 7 at 128,237,086 bp
  • A to T, chromosome 7 at 140,774,716 bp
  • T to C, chromosome 7 at 141,817,601 bp
  • C to T, chromosome 7 at 144,409,468 bp
  • A to T, chromosome 8 at 70,285,434 bp
  • A to G, chromosome 8 at 109,596,153 bp
  • C to T, chromosome 8 at 119,467,598 bp
  • A to G, chromosome 9 at 44,506,803 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 89,910,118 bp
  • A to G, chromosome 9 at 90,012,866 bp
  • T to A, chromosome 9 at 107,979,805 bp
  • T to A, chromosome 10 at 11,290,195 bp
  • C to T, chromosome 10 at 14,655,816 bp
  • C to T, chromosome 10 at 69,986,206 bp
  • T to C, chromosome 10 at 79,675,620 bp
  • A to G, chromosome 10 at 79,886,791 bp
  • T to A, chromosome 10 at 115,202,587 bp
  • A to G, chromosome 11 at 6,605,726 bp
  • G to A, chromosome 11 at 9,277,973 bp
  • A to C, chromosome 11 at 20,727,074 bp
  • C to T, chromosome 11 at 53,284,199 bp
  • T to C, chromosome 11 at 76,456,608 bp
  • T to G, chromosome 11 at 77,076,719 bp
  • C to T, chromosome 11 at 77,882,118 bp
  • A to G, chromosome 11 at 98,706,432 bp
  • A to G, chromosome 11 at 99,936,576 bp
  • G to A, chromosome 11 at 101,276,362 bp
  • G to A, chromosome 11 at 102,204,504 bp
  • T to G, chromosome 11 at 106,992,664 bp
  • T to A, chromosome 11 at 110,130,570 bp
  • A to G, chromosome 11 at 119,445,745 bp
  • A to T, chromosome 12 at 59,200,928 bp
  • T to C, chromosome 12 at 76,627,110 bp
  • A to G, chromosome 12 at 82,341,194 bp
  • T to C, chromosome 13 at 4,065,338 bp
  • A to T, chromosome 13 at 18,811,622 bp
  • A to T, chromosome 13 at 19,675,638 bp
  • A to C, chromosome 13 at 21,317,064 bp
  • G to A, chromosome 13 at 73,628,063 bp
  • T to C, chromosome 13 at 74,746,047 bp
  • T to C, chromosome 14 at 25,699,499 bp
  • T to A, chromosome 14 at 54,468,592 bp
  • T to A, chromosome 14 at 55,542,561 bp
  • A to T, chromosome 15 at 6,842,852 bp
  • C to T, chromosome 15 at 101,735,466 bp
  • A to G, chromosome 16 at 20,686,515 bp
  • G to A, chromosome 16 at 22,937,895 bp
  • T to C, chromosome 16 at 32,679,857 bp
  • A to G, chromosome 16 at 34,879,169 bp
  • A to T, chromosome 17 at 35,659,343 bp
  • A to T, chromosome 17 at 71,391,468 bp
  • A to G, chromosome 18 at 12,153,983 bp
  • G to A, chromosome 18 at 37,006,944 bp
  • T to C, chromosome 18 at 59,175,800 bp
  • A to G, chromosome 18 at 65,998,434 bp
  • A to T, chromosome 19 at 4,166,418 bp
  • T to C, chromosome 19 at 5,980,460 bp
  • T to C, chromosome 19 at 7,691,145 bp
  • T to A, chromosome 19 at 10,250,394 bp
  • T to A, chromosome 19 at 12,109,177 bp
  • A to T, chromosome 19 at 46,483,649 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4751 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041970-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.