Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4634Btlr/Mmmh
Stock Number:
042009-MU
Citation ID:
RRID:MMRRC_042009-MU
Other Names:
R4634 (G1), C57BL/6J-MtgxR4634Btlr
Major Collection:

Strain Information

Myd88
Name: myeloid differentiation primary response gene 88
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17874
HGNC: HGNC:7562
Homologene: 1849
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Hira
Name: histone cell cycle regulator
Synonyms: Tuple1, D16Ertd95e, Gm15797
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15260
HGNC: HGNC:4916
Homologene: 48172
Cops2
Name: COP9 signalosome subunit 2
Synonyms: Sgn2, Trip15, alien-like, alien homologue, Csn2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12848
Homologene: 3124
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Kif2c
Name: kinesin family member 2C
Synonyms: 4930402F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73804
HGNC: HGNC:6393
Homologene: 21355
Slc39a4
Name: solute carrier family 39 (zinc transporter), member 4
Synonyms: zip4, 1600025H15Rik, AWMS2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72027
VEGA: 15
Homologene: 15638
Sec1
Name: secretory blood group 1
Synonyms: Fut3, GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase FUT-III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56546
Homologene: 431
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Cand2
Name: cullin associated and neddylation dissociated 2 (putative)
Synonyms: Tp120b, 2210404G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67088
Homologene: 41657
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76800
Homologene: 35425
Brd8
Name: bromodomain containing 8
Synonyms: p120, SMAP, 2610007E11Rik, 4432404P07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78656
Homologene: 41790
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
A830010M20Rik
Name: RIKEN cDNA A830010M20 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231570
VEGA: 5
Homologene: 128318
Zfp280b
Name: zinc finger protein 280B
Synonyms: D10Jhu82e, Suhw2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64453
VEGA: 10
Homologene: 62794
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Marveld2
Name: MARVEL (membrane-associating) domain containing 2
Synonyms: Mrvldc2, Tricellulin, Tric, Tric-c, Tric-b, Tric-a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218518
VEGA: 13
Homologene: 27037
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ipcef1
Name: interaction protein for cytohesin exchange factors 1
Synonyms: A130090K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320495
Homologene: 32271
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Csf1
Name: colony stimulating factor 1 (macrophage)
Synonyms: CSF-1, M-CSF, colony-stimulating factor-1, Csfm, BAP025
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12977
HGNC: HGNC:2432
Homologene: 7282
Rabepk
Name: Rab9 effector protein with kelch motifs
Synonyms: 8430412M01Rik, 9530020D24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227746
Homologene: 48772
Vmn1r231
Name: vomeronasal 1 receptor 231
Synonyms: V1re7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171230
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Fscn2
Name: fascin actin-bundling protein 2
Synonyms: C630046B20Rik, ahl8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 238021
HGNC: HGNC:3960
Homologene: 22722
Ttbk2
Name: tau tubulin kinase 2
Synonyms: TTK, B930008N24Rik, 2610507N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Rcn3
Name: reticulocalbin 3, EF-hand calcium binding domain
Synonyms: 6030455P07Rik, RLP49, D7Ertd671e, D530026G20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52377
Homologene: 10775
Cln8
Name: CLN8 transmembrane ER and ERGIC protein
Synonyms: Tlcd6, ceroid-lipofuscinosis, neuronal 8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26889
HGNC: HGNC:2079
Homologene: 10340
Ears2
Name: glutamyl-tRNA synthetase 2, mitochondrial
Synonyms: 3230401I01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67417
Homologene: 6907
Ccdc121
Name: coiled-coil domain containing 121
Synonyms: 4930548H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67656
Gprin1
Name: G protein-regulated inducer of neurite outgrowth 1
Synonyms: Z16, GRIN1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26913
Homologene: 8072
Or4a76
Name: olfactory receptor family 4 subfamily A member 76
Synonyms: GA_x6K02T2Q125-51072323-51071367, MOR231-16P, MOR231-25_p, MOR231-16P, MOR231-17P, Olfr1541-ps1, Olfr1249
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257984
Ceacam16
Name: CEA cell adhesion molecule 16
Synonyms: LOC330483
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330483
Homologene: 19857
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 34,780,740 bp
  • A to C, chromosome 2 at 89,630,172 bp
  • A to G, chromosome 2 at 120,740,192 bp
  • C to A, chromosome 2 at 125,344,061 bp
  • C to A, chromosome 2 at 125,840,480 bp
  • C to T, chromosome 3 at 107,749,167 bp
  • T to C, chromosome 4 at 117,178,240 bp
  • G to A, chromosome 5 at 31,488,091 bp
  • G to T, chromosome 5 at 34,875,948 bp
  • A to T, chromosome 5 at 107,508,213 bp
  • C to T, chromosome 5 at 143,715,057 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • T to A, chromosome 6 at 115,797,987 bp
  • T to C, chromosome 7 at 19,184,944 bp
  • T to A, chromosome 7 at 19,858,606 bp
  • T to A, chromosome 7 at 45,088,668 bp
  • T to A, chromosome 7 at 45,678,873 bp
  • T to A, chromosome 7 at 122,044,609 bp
  • C to T, chromosome 8 at 14,894,842 bp
  • T to C, chromosome 9 at 53,531,733 bp
  • G to A, chromosome 9 at 119,338,109 bp
  • T to A, chromosome 10 at 6,919,829 bp
  • T to C, chromosome 10 at 76,038,829 bp
  • TGCTGCCGCTGCCGC to TGCTGCCGCTGCCGCTGCCGC, chromosome 11 at 69,362,187 bp
  • A to T, chromosome 11 at 120,367,720 bp
  • G to T, chromosome 12 at 101,837,616 bp
  • A to T, chromosome 13 at 46,687,230 bp
  • G to T, chromosome 13 at 54,738,058 bp
  • A to G, chromosome 13 at 100,611,939 bp
  • A to G, chromosome 15 at 74,584,429 bp
  • T to C, chromosome 15 at 76,614,493 bp
  • T to C, chromosome 15 at 100,160,491 bp
  • C to A, chromosome 16 at 18,946,400 bp
  • A to G, chromosome 17 at 20,890,398 bp
  • T to C, chromosome 18 at 34,608,484 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4634 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042009-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.