Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4728Btlr/Mmmh
Stock Number:
042020-MU
Citation ID:
RRID:MMRRC_042020-MU
Other Names:
R4728 (G1), C57BL/6J-MtgxR4728Btlr
Major Collection:

Strain Information

Kif3c
Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16570
VEGA: 12
HGNC: HGNC:6321
Homologene: 55640
Foxp4
Name: forkhead box P4
Synonyms: 1200010K03Rik, 2310007G05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74123
Homologene: 12536
Ptdss2
Name: phosphatidylserine synthase 2
Synonyms: PSS2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27388
Homologene: 8462
Ddx23
Name: DEAD box helicase 23
Synonyms: 4921506D17Rik, 3110082M05Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74351
Homologene: 3542
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Eps8
Name: EGFR pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Ccdc163
Name: coiled-coil domain containing 163
Synonyms: 4933430J04Rik, 0610037D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68394
Homologene: 12265
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 106,982,844 bp
  • A to T, chromosome 1 at 166,663,311 bp
  • A to G, chromosome 1 at 175,656,763 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to A, chromosome 2 at 32,230,625 bp
  • T to C, chromosome 2 at 87,868,435 bp
  • A to T, chromosome 2 at 110,644,424 bp
  • T to A, chromosome 2 at 120,300,921 bp
  • T to C, chromosome 2 at 127,217,414 bp
  • T to A, chromosome 2 at 127,227,878 bp
  • A to G, chromosome 2 at 132,832,854 bp
  • T to C, chromosome 2 at 148,709,325 bp
  • T to C, chromosome 2 at 172,985,981 bp
  • A to G, chromosome 3 at 61,004,220 bp
  • A to G, chromosome 3 at 118,435,041 bp
  • C to T, chromosome 3 at 131,184,675 bp
  • GAAGTTGTTTGGAGATTCTTATCTTA to GA, chromosome 3 at 158,318,408 bp
  • A to G, chromosome 4 at 41,765,559 bp
  • C to A, chromosome 4 at 88,842,282 bp
  • A to G, chromosome 4 at 103,140,205 bp
  • C to T, chromosome 4 at 116,709,012 bp
  • A to G, chromosome 4 at 139,423,879 bp
  • A to G, chromosome 4 at 141,614,652 bp
  • A to G, chromosome 5 at 5,508,385 bp
  • T to A, chromosome 5 at 33,217,338 bp
  • A to G, chromosome 6 at 29,143,592 bp
  • G to A, chromosome 6 at 137,509,162 bp
  • C to A, chromosome 7 at 5,803,363 bp
  • T to A, chromosome 7 at 23,321,564 bp
  • T to C, chromosome 7 at 26,475,090 bp
  • T to C, chromosome 7 at 68,189,624 bp
  • T to A, chromosome 7 at 87,975,288 bp
  • T to C, chromosome 7 at 120,059,366 bp
  • T to G, chromosome 7 at 127,540,924 bp
  • A to G, chromosome 7 at 141,154,459 bp
  • A to G, chromosome 8 at 19,126,418 bp
  • C to T, chromosome 8 at 25,752,267 bp
  • G to A, chromosome 8 at 61,703,232 bp
  • A to C, chromosome 8 at 82,770,846 bp
  • C to T, chromosome 9 at 13,799,200 bp
  • A to G, chromosome 9 at 107,705,440 bp
  • A to G, chromosome 9 at 110,087,650 bp
  • C to T, chromosome 10 at 70,935,831 bp
  • T to A, chromosome 10 at 85,991,199 bp
  • T to C, chromosome 10 at 127,563,737 bp
  • T to A, chromosome 11 at 6,342,549 bp
  • G to C, chromosome 11 at 86,544,658 bp
  • A to T, chromosome 12 at 3,365,873 bp
  • T to A, chromosome 12 at 13,288,739 bp
  • G to T, chromosome 12 at 66,716,613 bp
  • A to T, chromosome 12 at 75,007,781 bp
  • A to T, chromosome 12 at 76,583,379 bp
  • T to A, chromosome 12 at 77,475,199 bp
  • C to T, chromosome 12 at 81,722,373 bp
  • A to T, chromosome 12 at 104,409,163 bp
  • A to T, chromosome 13 at 27,776,285 bp
  • A to G, chromosome 14 at 26,627,420 bp
  • T to A, chromosome 14 at 40,842,432 bp
  • C to T, chromosome 14 at 54,507,907 bp
  • A to C, chromosome 15 at 66,682,827 bp
  • G to A, chromosome 15 at 78,602,713 bp
  • A to T, chromosome 15 at 88,978,031 bp
  • A to T, chromosome 15 at 98,650,225 bp
  • C to T, chromosome 16 at 18,922,904 bp
  • T to C, chromosome 16 at 49,296,920 bp
  • T to G, chromosome 16 at 97,821,786 bp
  • A to G, chromosome 17 at 6,290,599 bp
  • A to G, chromosome 17 at 34,570,205 bp
  • T to C, chromosome 17 at 47,878,692 bp
  • C to A, chromosome 17 at 52,725,870 bp
  • G to T, chromosome 19 at 4,603,096 bp
  • A to T, chromosome 19 at 5,553,662 bp
  • A to G, chromosome 19 at 40,605,742 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4728 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042020-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.