Strain Name:
C57BL/6J-MtgxR4728Btlr/Mmmh
Stock Number:
042020-MU
Citation ID:
RRID:MMRRC_042020-MU
Other Names:
R4728 (G1), C57BL/6J-MtgxR4728Btlr
Major Collection:

Strain Information

Kif3c
Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16570
VEGA: 12
HGNC: HGNC:6321
Homologene: 55640
Foxp4
Name: forkhead box P4
Synonyms: 1200010K03Rik, 2310007G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74123
Homologene: 12536
Ptdss2
Name: phosphatidylserine synthase 2
Synonyms: PSS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27388
Homologene: 8462
Ddx23
Name: DEAD box helicase 23
Synonyms: 4921506D17Rik, 3110082M05Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74351
Homologene: 3542
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227723
Homologene: 106649
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Ccdc163
Name: coiled-coil domain containing 163
Synonyms: 4933430J04Rik, 0610037D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68394
Homologene: 12265
Rps6kb1
Name: ribosomal protein S6 kinase, polypeptide 1
Synonyms: p70/85s6k, p70s6k, S6K1, 2610318I15Rik, p70S6K1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72508
Homologene: 81703
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Hira
Name: histone cell cycle regulator
Synonyms: Tuple1, D16Ertd95e, Gm15797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 15260
HGNC: HGNC:4916
Homologene: 48172
Sema3f
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Synonyms: Sema IV, Semak
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20350
Homologene: 20885
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320632
Homologene: 5859
Ogdh
Name: oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms: alpha-ketoglutarate dehydrogenase, 2210412K19Rik, 2210403E04Rik, d1401
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18293
HGNC: HGNC:8124
Homologene: 55662
Rbm28
Name: RNA binding motif protein 28
Synonyms: 2810480G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68272
Homologene: 135952
Mier1
Name: MEIR1 treanscription regulator
Synonyms: 5830411K19Rik, 4933425I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 71148
Homologene: 136176
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 21819
Homologene: 2430
Prdm15
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 114604
Homologene: 56941
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 83675
Homologene: 12856
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Mtmr2
Name: myotubularin related protein 2
Synonyms: 6030445P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 77116
HGNC: HGNC:7450
Homologene: 22951
Lef1
Name: lymphoid enhancer binding factor 1
Synonyms: lymphoid enhancer factor 1, Lef-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 16842
HGNC: HGNC:6551
Homologene: 7813
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Pcx
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18563
VEGA: 19
HGNC: HGNC:8636
Homologene: 5422
Napb
Name: N-ethylmaleimide sensitive fusion protein attachment protein beta
Synonyms: SNARE, b-SNAP, I47, E161, Brp14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17957
Homologene: 5332
Sptb
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20741
Homologene: 295
Prmt5
Name: protein arginine N-methyltransferase 5
Synonyms: Jbp1, Jak-binding protein 1, Skb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 27374
Homologene: 4454
Fut8
Name: fucosyltransferase 8
Synonyms: alpha (1,6) fucosyltransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 53618
VEGA: 12
HGNC: HGNC:4019
Homologene: 9650
Ddhd2
Name: DDHD domain containing 2
Synonyms: SAMWD1, 2010305K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72108
Homologene: 66646
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72333
Homologene: 75052
Dennd6a
Name: DENN domain containing 6A
Synonyms: A630054L15Rik, Fam116a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 211922
Homologene: 13503
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Nlrp4a
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp-eta, E330028A19Rik, Nalp4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243880
Homologene: 79696
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Il11ra1
Name: interleukin 11 receptor, alpha chain 1
Synonyms: NR1, Il11ra, Il-11ra-alpha, Il-11ra
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16157
HGNC: HGNC:5967
Homologene: 88705
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242274
Homologene: 10817
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Fmo9
Name: flavin containing monooxygenase 9
Synonyms: 4831428F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240894
Homologene: 134192
Dhx30
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72831
Homologene: 15779
Serpina3n
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3N
Synonyms: Spi2-2, Spi2.2, Spi2/eb.4, antitrypsin, alpha-1 antiproteinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20716
HGNC: HGNC:16
Homologene: 111129
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320772
Homologene: 45659
Vmn1r63
Name: vomeronasal 1 receptor 63
Synonyms: V1R1, V1rd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 81017
Homologene: 41799
Notch4
Name: notch 4
Synonyms: Int-3, Int3, N4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18132
HGNC: HGNC:7884
Homologene: 3351
P2ry1
Name: purinergic receptor P2Y, G-protein coupled 1
Synonyms: P2Y1, P2Y1 receptor, P2y1r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18441
HGNC: HGNC:8539
Homologene: 1926
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Mcm8
Name: minichromosome maintenance 8 homologous recombination repair factor
Synonyms: 5730432L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66634
Homologene: 12001
Tctn3
Name: tectonic family member 3
Synonyms: Tect3, 4930521E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67590
Homologene: 9221
Spon2
Name: spondin 2, extracellular matrix protein
Synonyms: M-spondin, Mindin, 2310045I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100689
Homologene: 40843
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: Nalp-epsilon, 4930406H16Rik, Nalp4e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 446099
Homologene: 75315
Zfp330
Name: zinc finger protein 330
Synonyms: nucleolar autoantigen 36, NOA 36, Noa36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 30932
Homologene: 8714
Tmem82
Name: transmembrane protein 82
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 213989
Homologene: 27088
Cyth4
Name: cytohesin 4
Synonyms: 5830469K17Rik, 2510004M07Rik, Pscd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72318
VEGA: 15
HGNC: HGNC:9505
Homologene: 22750
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Prl7c1
Name: prolactin family 7, subfamily c, member 1
Synonyms: PLP-O, 1600017N11Rik, Prlpo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67505
HGNC: HGNC:9445
Homologene: 137377
Slc5a12
Name: solute carrier family 5 (sodium/glucose cotransporter), member 12
Synonyms: SMCT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241612
Homologene: 15107
Pla2g4f
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271844
Homologene: 77933
Kmo
Name: kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98256
HGNC: HGNC:6381
Homologene: 2729
Defb34
Name: defensin beta 34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 360211
Npdc1
Name: neural proliferation, differentiation and control 1
Synonyms: NPDC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18146
HGNC: HGNC:7899
Homologene: 32050
Serpinb13
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms: HURPIN, HUR7, headpin, PI13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241196
HGNC: HGNC:8944
Homologene: 22718
Bpifc
Name: BPI fold containing family C
Synonyms: Bpil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 270757
Homologene: 18383
Mlc1
Name: megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
Synonyms: Kiaa0027-hp, WKL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 170790
Homologene: 15775
Or5w19
Name: olfactory receptor family 5 subfamily W member 19
Synonyms: GA_x6K02T2Q125-49372426-49373358, MOR177-12, Olfr1152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258103
Homologene: 79357
Sh2d4b
Name: SH2 domain containing 4B
Synonyms: A430109M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 328381
Homologene: 19164
Ovol1
Name: ovo like zinc finger 1
Synonyms: Ovo1, movo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18426
VEGA: 19
HGNC: HGNC:8525
Homologene: 3354
Tmem181a
Name: transmembrane protein 181A
Synonyms: 5930418K15Rik, Gpr178, C76977, Tmem181
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 77106
Homologene: 44787
Cldn12
Name: claudin 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 64945
HGNC: HGNC:2034
Homologene: 40809
Gm5407
Name: predicted gene 5407
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 386061
VEGA: 16
Spo11
Name: SPO11 initiator of meiotic double stranded breaks
Synonyms: Spo11b, Spo11a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26972
Homologene: 6059
Gm9916
Name: predicted gene 9916
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 106,982,844 bp
  • A to T, chromosome 1 at 166,663,311 bp
  • A to G, chromosome 1 at 175,656,763 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to A, chromosome 2 at 32,230,625 bp
  • T to C, chromosome 2 at 87,868,435 bp
  • A to T, chromosome 2 at 110,644,424 bp
  • T to A, chromosome 2 at 120,300,921 bp
  • T to C, chromosome 2 at 127,217,414 bp
  • T to A, chromosome 2 at 127,227,878 bp
  • A to G, chromosome 2 at 132,832,854 bp
  • T to C, chromosome 2 at 148,709,325 bp
  • T to C, chromosome 2 at 172,985,981 bp
  • A to G, chromosome 3 at 61,004,220 bp
  • A to G, chromosome 3 at 118,435,041 bp
  • C to T, chromosome 3 at 131,184,675 bp
  • GAAGTTGTTTGGAGATTCTTATCTTA to GA, chromosome 3 at 158,318,408 bp
  • A to G, chromosome 4 at 41,765,559 bp
  • C to A, chromosome 4 at 88,842,282 bp
  • A to G, chromosome 4 at 103,140,205 bp
  • C to T, chromosome 4 at 116,709,012 bp
  • A to G, chromosome 4 at 139,423,879 bp
  • A to G, chromosome 4 at 141,614,652 bp
  • A to G, chromosome 5 at 5,508,385 bp
  • T to A, chromosome 5 at 33,217,338 bp
  • A to G, chromosome 6 at 29,143,592 bp
  • G to A, chromosome 6 at 137,509,162 bp
  • C to A, chromosome 7 at 5,803,363 bp
  • T to A, chromosome 7 at 23,321,564 bp
  • T to C, chromosome 7 at 26,475,090 bp
  • T to C, chromosome 7 at 68,189,624 bp
  • T to A, chromosome 7 at 87,975,288 bp
  • T to C, chromosome 7 at 120,059,366 bp
  • T to G, chromosome 7 at 127,540,924 bp
  • A to G, chromosome 7 at 141,154,459 bp
  • A to G, chromosome 8 at 19,126,418 bp
  • C to T, chromosome 8 at 25,752,267 bp
  • G to A, chromosome 8 at 61,703,232 bp
  • A to C, chromosome 8 at 82,770,846 bp
  • C to T, chromosome 9 at 13,799,200 bp
  • A to G, chromosome 9 at 107,705,440 bp
  • A to G, chromosome 9 at 110,087,650 bp
  • C to T, chromosome 10 at 70,935,831 bp
  • T to A, chromosome 10 at 85,991,199 bp
  • T to C, chromosome 10 at 127,563,737 bp
  • T to A, chromosome 11 at 6,342,549 bp
  • G to C, chromosome 11 at 86,544,658 bp
  • A to T, chromosome 12 at 3,365,873 bp
  • T to A, chromosome 12 at 13,288,739 bp
  • G to T, chromosome 12 at 66,716,613 bp
  • A to T, chromosome 12 at 75,007,781 bp
  • A to T, chromosome 12 at 76,583,379 bp
  • T to A, chromosome 12 at 77,475,199 bp
  • C to T, chromosome 12 at 81,722,373 bp
  • A to T, chromosome 12 at 104,409,163 bp
  • A to T, chromosome 13 at 27,776,285 bp
  • A to G, chromosome 14 at 26,627,420 bp
  • T to A, chromosome 14 at 40,842,432 bp
  • C to T, chromosome 14 at 54,507,907 bp
  • A to C, chromosome 15 at 66,682,827 bp
  • G to A, chromosome 15 at 78,602,713 bp
  • A to T, chromosome 15 at 88,978,031 bp
  • A to T, chromosome 15 at 98,650,225 bp
  • C to T, chromosome 16 at 18,922,904 bp
  • T to C, chromosome 16 at 49,296,920 bp
  • T to G, chromosome 16 at 97,821,786 bp
  • A to G, chromosome 17 at 6,290,599 bp
  • A to G, chromosome 17 at 34,570,205 bp
  • T to C, chromosome 17 at 47,878,692 bp
  • C to A, chromosome 17 at 52,725,870 bp
  • G to T, chromosome 19 at 4,603,096 bp
  • A to T, chromosome 19 at 5,553,662 bp
  • A to G, chromosome 19 at 40,605,742 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4728 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042020-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.