Strain Name:
Stock Number:
Citation ID:
Other Names:
R4728 (G1), C57BL/6J-MtgxR4728Btlr
Major Collection:

Strain Information

Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16570
VEGA: 12
Homologene: 55640
Name: forkhead box P4
Synonyms: 1200010K03Rik, 2310007G05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74123
Homologene: 12536
Name: phosphatidylserine synthase 2
Synonyms: PSS2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27388
Homologene: 8462
Name: DEAD box helicase 23
Synonyms: 4921506D17Rik, 3110082M05Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74351
Homologene: 3542
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
Homologene: 3272
Name: coiled-coil domain containing 163
Synonyms: 4933430J04Rik, 0610037D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68394
Homologene: 12265
Name: ribosomal protein S6 kinase, polypeptide 1
Synonyms: p70/85s6k, p70s6k, S6K1, 2610318I15Rik, p70S6K1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72508
Homologene: 81703
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
Homologene: 30997
Name: histone cell cycle regulator
Synonyms: Tuple1, D16Ertd95e, Gm15797
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15260
Homologene: 48172
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Synonyms: Sema IV, Semak
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20350
Homologene: 20885
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Name: oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms: alpha-ketoglutarate dehydrogenase, 2210412K19Rik, 2210403E04Rik, d1401
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18293
Homologene: 55662
Name: RNA binding motif protein 28
Synonyms: 2810480G15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68272
Homologene: 135952
Name: MEIR1 treanscription regulator
Synonyms: 5830411K19Rik, 4933425I22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71148
Homologene: 136176
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114604
Homologene: 56941
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83675
Homologene: 12856
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
Homologene: 15858
Name: myotubularin related protein 2
Synonyms: 6030445P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77116
Homologene: 22951
Name: lymphoid enhancer binding factor 1
Synonyms: lymphoid enhancer factor 1, Lef-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16842
Homologene: 7813
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18563
VEGA: 19
Homologene: 5422
Name: N-ethylmaleimide sensitive fusion protein attachment protein beta
Synonyms: SNARE, b-SNAP, I47, E161, Brp14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17957
Homologene: 5332
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20741
Homologene: 295
Name: protein arginine N-methyltransferase 5
Synonyms: Jbp1, Jak-binding protein 1, Skb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27374
Homologene: 4454
Name: fucosyltransferase 8
Synonyms: alpha (1,6) fucosyltransferase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 53618
VEGA: 12
Homologene: 9650
Name: DDHD domain containing 2
Synonyms: SAMWD1, 2010305K11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72108
Homologene: 66646
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72333
Homologene: 75052
Name: DENN domain containing 6A
Synonyms: A630054L15Rik, Fam116a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211922
Homologene: 13503
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
Homologene: 1744
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp-eta, E330028A19Rik, Nalp4a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243880
Homologene: 79696
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
Homologene: 19674
Name: interleukin 11 receptor subunit alpha 1
Synonyms: NR1, Il11ra, Il-11ra-alpha, Il-11ra
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16157
Homologene: 88705
Name: leucine rich repeat containing 7
Synonyms: densin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242274
Homologene: 10817
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108071
Homologene: 37354
Name: flavin containing monooxygenase 9
Synonyms: 4831428F09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240894
Homologene: 134192
Name: DExH-box helicase 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3N
Synonyms: Spi2-2, Spi2.2, Spi2/eb.4, antitrypsin, alpha-1 antiproteinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20716
Homologene: 111129
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Name: vomeronasal 1 receptor 63
Synonyms: V1R1, V1rd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81017
Homologene: 41799
Name: notch 4
Synonyms: Int-3, Int3, N4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18132
Homologene: 3351
Name: purinergic receptor P2Y, G-protein coupled 1
Synonyms: P2Y1, P2Y1 receptor, P2y1r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18441
Homologene: 1926
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: minichromosome maintenance 8 homologous recombination repair factor
Synonyms: 5730432L01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66634
Homologene: 12001
Name: tectonic family member 3
Synonyms: Tect3, 4930521E07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67590
Homologene: 9221
Name: spondin 2, extracellular matrix protein
Synonyms: M-spondin, Mindin, 2310045I24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100689
Homologene: 40843
Name: NLR family, pyrin domain containing 4E
Synonyms: Nalp-epsilon, Nalp4e, 4930406H16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446099
Homologene: 75315
Name: zinc finger protein 330
Synonyms: nucleolar autoantigen 36, NOA 36, Noa36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 30932
Homologene: 8714
Name: transmembrane protein 82
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 213989
Homologene: 27088
Name: cytohesin 4
Synonyms: 5830469K17Rik, 2510004M07Rik, Pscd4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72318
VEGA: 15
Homologene: 22750
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
Homologene: 76377
Name: prolactin family 7, subfamily c, member 1
Synonyms: PLP-O, 1600017N11Rik, Prlpo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67505
Homologene: 137377
Name: solute carrier family 5 (sodium/glucose cotransporter), member 12
Synonyms: SMCT2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241612
Homologene: 15107
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271844
Homologene: 77933
Name: kynurenine 3-monooxygenase
Synonyms: kynurenine 3-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98256
Homologene: 2729
Name: defensin beta 34
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 360211
Name: neural proliferation, differentiation and control 1
Synonyms: NPDC-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18146
Homologene: 32050
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms: headpin, PI13, HURPIN, HUR7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241196
Homologene: 22718
Name: BPI fold containing family C
Synonyms: Bpil2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270757
Homologene: 18383
Name: megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
Synonyms: Kiaa0027-hp, WKL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170790
Homologene: 15775
Name: olfactory receptor family 5 subfamily W member 19
Synonyms: GA_x6K02T2Q125-49372426-49373358, MOR177-12, Olfr1152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258103
Homologene: 79357
Name: SH2 domain containing 4B
Synonyms: A430109M18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328381
Homologene: 19164
Name: ovo like zinc finger 1
Synonyms: Ovo1, movo1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18426
VEGA: 19
Homologene: 3354
Name: transmembrane protein 181A
Synonyms: 5930418K15Rik, Gpr178, C76977, Tmem181
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77106
Homologene: 44787
Name: claudin 12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64945
Homologene: 40809
Name: predicted gene 5407
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 386061
VEGA: 16
Name: SPO11 initiator of meiotic double stranded breaks
Synonyms: Spo11b, Spo11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26972
Homologene: 6059
Name: predicted gene 9916
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 106,982,844 bp
  • A to T, chromosome 1 at 166,663,311 bp
  • A to G, chromosome 1 at 175,656,763 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to A, chromosome 2 at 32,230,625 bp
  • T to C, chromosome 2 at 87,868,435 bp
  • A to T, chromosome 2 at 110,644,424 bp
  • T to A, chromosome 2 at 120,300,921 bp
  • T to C, chromosome 2 at 127,217,414 bp
  • T to A, chromosome 2 at 127,227,878 bp
  • A to G, chromosome 2 at 132,832,854 bp
  • T to C, chromosome 2 at 148,709,325 bp
  • T to C, chromosome 2 at 172,985,981 bp
  • A to G, chromosome 3 at 61,004,220 bp
  • A to G, chromosome 3 at 118,435,041 bp
  • C to T, chromosome 3 at 131,184,675 bp
  • GAAGTTGTTTGGAGATTCTTATCTTA to GA, chromosome 3 at 158,318,408 bp
  • A to G, chromosome 4 at 41,765,559 bp
  • C to A, chromosome 4 at 88,842,282 bp
  • A to G, chromosome 4 at 103,140,205 bp
  • C to T, chromosome 4 at 116,709,012 bp
  • A to G, chromosome 4 at 139,423,879 bp
  • A to G, chromosome 4 at 141,614,652 bp
  • A to G, chromosome 5 at 5,508,385 bp
  • T to A, chromosome 5 at 33,217,338 bp
  • A to G, chromosome 6 at 29,143,592 bp
  • G to A, chromosome 6 at 137,509,162 bp
  • C to A, chromosome 7 at 5,803,363 bp
  • T to A, chromosome 7 at 23,321,564 bp
  • T to C, chromosome 7 at 26,475,090 bp
  • T to C, chromosome 7 at 68,189,624 bp
  • T to A, chromosome 7 at 87,975,288 bp
  • T to C, chromosome 7 at 120,059,366 bp
  • T to G, chromosome 7 at 127,540,924 bp
  • A to G, chromosome 7 at 141,154,459 bp
  • A to G, chromosome 8 at 19,126,418 bp
  • C to T, chromosome 8 at 25,752,267 bp
  • G to A, chromosome 8 at 61,703,232 bp
  • A to C, chromosome 8 at 82,770,846 bp
  • C to T, chromosome 9 at 13,799,200 bp
  • A to G, chromosome 9 at 107,705,440 bp
  • A to G, chromosome 9 at 110,087,650 bp
  • C to T, chromosome 10 at 70,935,831 bp
  • T to A, chromosome 10 at 85,991,199 bp
  • T to C, chromosome 10 at 127,563,737 bp
  • T to A, chromosome 11 at 6,342,549 bp
  • G to C, chromosome 11 at 86,544,658 bp
  • A to T, chromosome 12 at 3,365,873 bp
  • T to A, chromosome 12 at 13,288,739 bp
  • G to T, chromosome 12 at 66,716,613 bp
  • A to T, chromosome 12 at 75,007,781 bp
  • A to T, chromosome 12 at 76,583,379 bp
  • T to A, chromosome 12 at 77,475,199 bp
  • C to T, chromosome 12 at 81,722,373 bp
  • A to T, chromosome 12 at 104,409,163 bp
  • A to T, chromosome 13 at 27,776,285 bp
  • A to G, chromosome 14 at 26,627,420 bp
  • T to A, chromosome 14 at 40,842,432 bp
  • C to T, chromosome 14 at 54,507,907 bp
  • A to C, chromosome 15 at 66,682,827 bp
  • G to A, chromosome 15 at 78,602,713 bp
  • A to T, chromosome 15 at 88,978,031 bp
  • A to T, chromosome 15 at 98,650,225 bp
  • C to T, chromosome 16 at 18,922,904 bp
  • T to C, chromosome 16 at 49,296,920 bp
  • T to G, chromosome 16 at 97,821,786 bp
  • A to G, chromosome 17 at 6,290,599 bp
  • A to G, chromosome 17 at 34,570,205 bp
  • T to C, chromosome 17 at 47,878,692 bp
  • C to A, chromosome 17 at 52,725,870 bp
  • G to T, chromosome 19 at 4,603,096 bp
  • A to T, chromosome 19 at 5,553,662 bp
  • A to G, chromosome 19 at 40,605,742 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4728 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042020-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.