Strain Name:
C57BL/6J-MtgxR4750Btlr/Mmmh
Stock Number:
042031-MU
Citation ID:
RRID:MMRRC_042031-MU
Other Names:
R4750 (G1), C57BL/6J-MtgxR4750Btlr
Major Collection:

Strain Information

Nsmf
Name: NMDA receptor synaptonuclear signaling and neuronal migration factor
Synonyms: Jacob, Nelf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56876
Homologene: 10648
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 54524
Homologene: 10301
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 57138
Homologene: 10665
Agt
Name: angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Synonyms: angiotensin precursor, Serpina8, Aogen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Prkcd
Name: protein kinase C, delta
Synonyms: PKC[d], Pkcd, D14Ertd420e, PKCdelta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 18753
HGNC: HGNC:9399
Homologene: 55963
Cdk19
Name: cyclin dependent kinase 19
Synonyms: Cdc2l6, 2700084L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Plekha7
Name: pleckstrin homology domain containing, family A member 7
Synonyms: A430081P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233765
Homologene: 52172
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232947
Homologene: 17851
Nek7
Name: NIMA (never in mitosis gene a)-related expressed kinase 7
Synonyms: 2810460C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 59125
Homologene: 69340
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: Myosin IIB, nonmuscle myosin heavy chain II-B, 9330167F11Rik, 5730504C04Rik, NMHC II-B, NMHC-B, Myhn2, nonmuscle myosin heavy chain IIB, SMemb, myosin IIB, Fltn, Fltn, Myhn-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Washc4
Name: WASH complex subunit 4
Synonyms: A230046K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319277
VEGA: 10
Homologene: 123926
Foxj3
Name: forkhead box J3
Synonyms: C330039G02Rik, Fhd6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230700
Homologene: 35243
Fbxo21
Name: F-box protein 21
Synonyms: 2810425J22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231670
Homologene: 14145
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66887
Homologene: 12050
Pip4k2c
Name: phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Synonyms: Pip5k2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 117150
VEGA: 10
Homologene: 23484
Polr2b
Name: polymerase (RNA) II (DNA directed) polypeptide B
Synonyms: RPB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231329
HGNC: HGNC:9188
Homologene: 722
Spag5
Name: sperm associated antigen 5
Synonyms: s17, S17, D11Bhm180e, MAP126, Astrin, Mastrin, Deepest
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 54141
Homologene: 4718
Arhgef1
Name: Rho guanine nucleotide exchange factor (GEF) 1
Synonyms: Lbcl2, Lsc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16801
HGNC: HGNC:681
Homologene: 3454
Isl2
Name: insulin related protein 2 (islet 2)
Synonyms: islet-2, islet 2, 3110001N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 104360
Homologene: 10730
Lsg1
Name: large 60S subunit nuclear export GTPase 1
Synonyms: D16Bwg1547e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224092
Homologene: 5917
Exosc10
Name: exosome component 10
Synonyms: p3, p4, p2, RRP6, Pmscl2, PM/Scl-100, PM-Scl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 50912
HGNC: HGNC:9138
Homologene: 31105
Cul4a
Name: cullin 4A
Synonyms: 2810470J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 99375
HGNC: HGNC:2554
Homologene: 81724
Dync2i2
Name: dynein 2 intermediate chain 2
Synonyms: Wdr34, 3200002I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71820
Homologene: 14156
Prdm4
Name: PR domain containing 4
Synonyms: SC1, 1700031E19Rik, SC-1, 2810470D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 72843
VEGA: 10
HGNC: HGNC:9348
Homologene: 8235
Zfp142
Name: zinc finger protein 142
Synonyms: 9330177B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77264
Homologene: 3723
Nepro
Name: nucleolus and neural progenitor protein
Synonyms: BC027231
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212547
Homologene: 9127
Bbln
Name: bublin coiled coil protein
Synonyms: C79326, 1110008P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73737
Homologene: 41552
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: Evi1, Mds1, Jbo, D630039M04Rik, ZNFPR1B1, Prdm3, Evi-1, MDS1-EVI1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: Ttc40, 9330101J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 212124
Adamts4
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonyms: aggrecanase-1, ADAM-TS4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240913
HGNC: HGNC:220
Homologene: 36169
Or1n2
Name: olfactory receptor family 1 subfamily N member 2
Synonyms: MOR127-4, Olfr354, GA_x6K02T2NLDC-33601476-33602429
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258941
Homologene: 17443
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237954
Homologene: 138824
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Kcp
Name: kielin/chordin-like protein
Synonyms: KCP, Crim2, LOC333088
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 333088
Homologene: 87817
Enpp4
Name: ectonucleotide pyrophosphatase/phosphodiesterase 4
Synonyms: 4933413N07Rik, LOC224794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224794
HGNC: HGNC:3359
Homologene: 28264
Lama3
Name: laminin, alpha 3
Synonyms: [a]3B, nicein, 150kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Ankrd52
Name: ankyrin repeat domain 52
Synonyms: G431002C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237615
Homologene: 18227
P2rx5
Name: purinergic receptor P2X, ligand-gated ion channel, 5
Synonyms: P2X5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 94045
HGNC: HGNC:8536
Homologene: 1924
Aadat
Name: aminoadipate aminotransferase
Synonyms: mKat-2, KATII, Kyat2, Kat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 23923
Homologene: 56540
Or1p1c
Name: olfactory receptor family 1 subfamily P member 1C
Synonyms: Olfr406, GA_x6K02T2P1NL-4415162-4416133, MOR133-1, Olfr406-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258181
HGNC: HGNC:8222
Gas6
Name: growth arrest specific 6
Synonyms: Gas-6, growth arrest-specific, GAS 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14456
HGNC: HGNC:4168
Homologene: 638
Or13n4
Name: olfactory receptor family 13 subfamily N member 4
Synonyms: Olfr702, MOR260-4, GA_x6K02T2PBJ9-9202245-9201289
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258590
Homologene: 121512
Asns
Name: asparagine synthetase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 27053
HGNC: HGNC:753
Homologene: 69113
Prss59
Name: protease, serine 59
Synonyms: 1700074P13Rik, Tryx5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 73481
Homologene: 49905
Cdh12
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 215654
HGNC: HGNC:1751
Homologene: 37873
Usp35
Name: ubiquitin specific peptidase 35
Synonyms: LOC381901, LOC244144
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244144
Homologene: 35459
Bbox1
Name: butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 (gamma-butyrobetaine hydroxylase)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 170442
HGNC: HGNC:964
Homologene: 2967
Cd109
Name: CD109 antigen
Synonyms: 9930012E15Rik, Gov platelet alloantigens
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214321
Homologene: 86950
Or10x1
Name: olfactory receptor family 10 subfamily X member 1
Synonyms: Olfr417, GA_x6K02T2P20D-20787051-20786119, MOR267-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258238
Homologene: 17358
Tmem247
Name: transmembrane protein 247
Synonyms: 1700090G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78469
Homologene: 54379
Bmp3
Name: bone morphogenetic protein 3
Synonyms: 9530029I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 110075
HGNC: HGNC:1070
Homologene: 927
Daglb
Name: diacylglycerol lipase, beta
Synonyms: E330036I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231871
Homologene: 34715
Smarca5
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms: 4933427E24Rik, MommeD4, D030040M08Rik, D330027N15Rik, Snf2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93762
Homologene: 55764
Ppm1l
Name: protein phosphatase 1 (formerly 2C)-like
Synonyms: Pp2ce, 5930404J21Rik, PP2C-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242083
Homologene: 33158
Acan
Name: aggrecan
Synonyms: Agc1, Cspg1, b2b183Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Ap1g2
Name: adaptor protein complex AP-1, gamma 2 subunit
Synonyms: Adtg2, gamma 2-adaptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11766
HGNC: HGNC:556
Homologene: 49141
Cfhr3
Name: complement factor H-related 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 624286
Homologene: 138664
Hmgxb3
Name: HMG box domain containing 3
Synonyms: A630042L21Rik, 2510002C16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Xylb
Name: xylulokinase homolog (H. influenzae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102448
VEGA: 9
Homologene: 3746
Nexn
Name: nexilin
Synonyms: nF actin binding protein, 1110046H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68810
Homologene: 44892
Aadac
Name: arylacetamide deacetylase
Synonyms: Aada, 5033417E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67758
HGNC: HGNC:17
Homologene: 37436
Kif12
Name: kinesin family member 12
Synonyms: N-9 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16552
Homologene: 7796
Gramd2b
Name: GRAM domain containing 2B
Synonyms: 9030613F08Rik, Gramd3, 9130427A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 107022
VEGA: 18
Homologene: 32570
Or13p5
Name: olfactory receptor family 13 subfamily P member 5
Synonyms: GA_x6K02T2QD9B-18815145-18814198, MOR258-2, Olfr1339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258851
Homologene: 27280
Lrif1
Name: ligand dependent nuclear receptor interacting factor 1
Synonyms: 2010012G17Rik, 4933421E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 321000
Homologene: 10160
Or5bw2
Name: olfactory receptor family 5 subfamily BW member 2
Synonyms: Olfr1350, GA_x6K02T2QGBW-3300391-3301317, MOR222-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258384
Rcor3
Name: REST corepressor 3
Synonyms: C730034D20Rik, E130101E15Rik, 4921514E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214742
Homologene: 135671
Or5w16
Name: olfactory receptor family 5 subfamily W member 16
Synonyms: Olfr1140, GA_x6K02T2Q125-49250025-49250960, MOR177-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258635
Homologene: 74081
Or2w2
Name: olfactory receptor family 2 subfamily W member 2
Synonyms: GA_x6K02T2QHY8-11663090-11664010, Olfr1364, MOR256-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 258533
Homologene: 64885
Kcns3
Name: potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Synonyms: D12Ertd137e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238076
VEGA: 12
HGNC: HGNC:6302
Homologene: 20518
Ctrc
Name: chymotrypsin C (caldecrin)
Synonyms: 1810044E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76701
HGNC: HGNC:2523
Homologene: 21422
Pcdhb20
Name: protocadherin beta 20
Synonyms: PcdhbT, Pcdhb14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93891
HGNC: HGNC:8685
Homologene: 134303
Rab3gap1
Name: RAB3 GTPase activating protein subunit 1
Synonyms: 1700003B17Rik, 4732493F09Rik, p130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226407
Homologene: 45617
Or52l1
Name: olfactory receptor family 52 subfamily L member 1
Synonyms: MOR37-1, Olfr685, GA_x6K02T2PBJ9-7810071-7809121
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258160
Homologene: 66455
Slco5a1
Name: solute carrier organic anion transporter family, member 5A1
Synonyms: A630033C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240726
Homologene: 57135
2510039O18Rik
Name: RIKEN cDNA 2510039O18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77034
Homologene: 12668
Loxl4
Name: lysyl oxidase-like 4
Synonyms: 4833426I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67573
Homologene: 12977
Gimap8
Name: GTPase, IMAP family member 8
Synonyms: LOC243374, IAN9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243374
Homologene: 69703
Spint4
Name: serine protease inhibitor, Kunitz type 4
Synonyms: 9230105I15Rik, Spint4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78239
Homologene: 49932
Zfp239
Name: zinc finger protein 239
Synonyms: Mok-2, Mok2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22685
Homologene: 68480
Tmem72
Name: transmembrane protein 72
Synonyms: C230095G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 319776
Homologene: 18704
Arf2
Name: ADP-ribosylation factor 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11841
Homologene: 56086
Hoxb3os
Name: homeobox B3 and homeobox B2, opposite strand
Synonyms: Gm11530
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 102632302
Gm6185
Name: predicted gene 6185
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 620839
Gm5852
Name: predicted gene 5852
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 545550
Rdh5
Name: retinol dehydrogenase 5
Synonyms: cRDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19682
HGNC: HGNC:9940
Homologene: 2179
Gm17473
Name: predicted gene, 17473
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 12,879,280 bp
  • T to A, chromosome 1 at 20,524,112 bp
  • T to C, chromosome 1 at 74,572,458 bp
  • A to G, chromosome 1 at 127,942,436 bp
  • C to T, chromosome 1 at 138,498,673 bp
  • T to A, chromosome 1 at 139,584,828 bp
  • T to C, chromosome 1 at 161,182,363 bp
  • T to A, chromosome 1 at 171,251,066 bp
  • A to G, chromosome 1 at 174,368,922 bp
  • A to G, chromosome 1 at 192,130,449 bp
  • T to C, chromosome 2 at 25,055,026 bp
  • T to C, chromosome 2 at 30,033,920 bp
  • C to T, chromosome 2 at 32,379,413 bp
  • T to A, chromosome 2 at 36,907,716 bp
  • C to T, chromosome 2 at 87,746,508 bp
  • T to A, chromosome 2 at 110,265,521 bp
  • A to T, chromosome 2 at 164,700,146 bp
  • A to G, chromosome 2 at 164,982,931 bp
  • T to G, chromosome 3 at 29,957,530 bp
  • T to C, chromosome 3 at 60,035,817 bp
  • A to G, chromosome 3 at 69,549,328 bp
  • A to T, chromosome 3 at 93,727,264 bp
  • T to A, chromosome 3 at 103,630,917 bp
  • C to A, chromosome 3 at 106,735,564 bp
  • A to G, chromosome 3 at 152,237,722 bp
  • T to A, chromosome 4 at 63,167,783 bp
  • T to A, chromosome 4 at 118,734,733 bp
  • C to A, chromosome 4 at 119,616,590 bp
  • T to A, chromosome 4 at 141,841,523 bp
  • T to A, chromosome 4 at 147,941,488 bp
  • T to A, chromosome 4 at 148,562,394 bp
  • A to C, chromosome 5 at 77,332,039 bp
  • A to G, chromosome 5 at 98,872,558 bp
  • G to A, chromosome 5 at 118,000,468 bp
  • A to G, chromosome 5 at 143,472,966 bp
  • A to G, chromosome 6 at 7,682,007 bp
  • G to A, chromosome 6 at 29,484,626 bp
  • A to G, chromosome 6 at 40,921,021 bp
  • A to G, chromosome 6 at 48,650,427 bp
  • A to G, chromosome 6 at 116,695,434 bp
  • A to G, chromosome 6 at 117,871,739 bp
  • A to G, chromosome 7 at 6,570,851 bp
  • G to T, chromosome 7 at 19,531,520 bp
  • A to G, chromosome 7 at 24,918,576 bp
  • C to A, chromosome 7 at 79,092,718 bp
  • A to G, chromosome 7 at 97,310,339 bp
  • A to T, chromosome 7 at 105,180,926 bp
  • A to G, chromosome 7 at 106,824,307 bp
  • A to T, chromosome 7 at 116,137,311 bp
  • A to G, chromosome 7 at 139,679,323 bp
  • A to T, chromosome 8 at 13,142,561 bp
  • T to G, chromosome 8 at 13,476,227 bp
  • T to A, chromosome 8 at 60,526,600 bp
  • A to C, chromosome 8 at 80,733,707 bp
  • A to T, chromosome 8 at 86,631,502 bp
  • A to G, chromosome 8 at 124,556,937 bp
  • T to A, chromosome 9 at 55,544,312 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • G to T, chromosome 9 at 119,359,313 bp
  • T to C, chromosome 10 at 40,476,199 bp
  • T to C, chromosome 10 at 83,591,052 bp
  • A to G, chromosome 10 at 85,899,221 bp
  • T to C, chromosome 10 at 91,060,188 bp
  • T to C, chromosome 10 at 127,211,417 bp
  • A to C, chromosome 10 at 128,378,089 bp
  • T to C, chromosome 10 at 128,918,366 bp
  • T to C, chromosome 11 at 68,785,314 bp
  • G to T, chromosome 11 at 73,164,877 bp
  • T to A, chromosome 11 at 74,269,420 bp
  • T to C, chromosome 11 at 78,320,052 bp
  • T to C, chromosome 11 at 96,345,541 bp
  • T to A, chromosome 11 at 103,455,480 bp
  • T to C, chromosome 11 at 103,979,759 bp
  • T to A, chromosome 12 at 11,091,654 bp
  • T to C, chromosome 12 at 81,378,367 bp
  • A to G, chromosome 13 at 21,573,743 bp
  • A to G, chromosome 14 at 30,610,301 bp
  • G to T, chromosome 14 at 55,104,365 bp
  • T to A, chromosome 15 at 21,583,808 bp
  • T to C, chromosome 15 at 42,676,401 bp
  • A to G, chromosome 16 at 30,565,449 bp
  • T to C, chromosome 16 at 44,730,182 bp
  • A to G, chromosome 17 at 44,102,355 bp
  • T to C, chromosome 17 at 86,922,342 bp
  • T to A, chromosome 18 at 12,504,359 bp
  • C to A, chromosome 18 at 37,506,131 bp
  • A to G, chromosome 18 at 56,432,300 bp
  • A to T, chromosome 18 at 61,167,496 bp
  • T to C, chromosome 19 at 18,876,064 bp
  • T to A, chromosome 19 at 42,605,004 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4750 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042031-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.