Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4750Btlr/Mmmh
Stock Number:
042031-MU
Citation ID:
RRID:MMRRC_042031-MU
Other Names:
R4750 (G1), C57BL/6J-MtgxR4750Btlr
Major Collection:

Strain Information

Nsmf
Name: NMDA receptor synaptonuclear signaling and neuronal migration factor
Synonyms: Jacob, Nelf
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56876
Homologene: 10648
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57138
Homologene: 10665
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Prkcd
Name: protein kinase C, delta
Synonyms: PKCdelta, PKC[d], Pkcd, D14Ertd420e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18753
HGNC: HGNC:9399
Homologene: 55963
Cdk19
Name: cyclin dependent kinase 19
Synonyms: 2700084L06Rik, Cdc2l6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Plekha7
Name: pleckstrin homology domain containing A7
Synonyms: A430081P20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233765
Homologene: 52172
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 12,879,280 bp
  • T to A, chromosome 1 at 20,524,112 bp
  • T to C, chromosome 1 at 74,572,458 bp
  • A to G, chromosome 1 at 127,942,436 bp
  • C to T, chromosome 1 at 138,498,673 bp
  • T to A, chromosome 1 at 139,584,828 bp
  • T to C, chromosome 1 at 161,182,363 bp
  • T to A, chromosome 1 at 171,251,066 bp
  • A to G, chromosome 1 at 174,368,922 bp
  • A to G, chromosome 1 at 192,130,449 bp
  • T to C, chromosome 2 at 25,055,026 bp
  • T to C, chromosome 2 at 30,033,920 bp
  • C to T, chromosome 2 at 32,379,413 bp
  • T to A, chromosome 2 at 36,907,716 bp
  • C to T, chromosome 2 at 87,746,508 bp
  • T to A, chromosome 2 at 110,265,521 bp
  • A to T, chromosome 2 at 164,700,146 bp
  • A to G, chromosome 2 at 164,982,931 bp
  • T to G, chromosome 3 at 29,957,530 bp
  • T to C, chromosome 3 at 60,035,817 bp
  • A to G, chromosome 3 at 69,549,328 bp
  • A to T, chromosome 3 at 93,727,264 bp
  • T to A, chromosome 3 at 103,630,917 bp
  • C to A, chromosome 3 at 106,735,564 bp
  • A to G, chromosome 3 at 152,237,722 bp
  • T to A, chromosome 4 at 63,167,783 bp
  • T to A, chromosome 4 at 118,734,733 bp
  • C to A, chromosome 4 at 119,616,590 bp
  • T to A, chromosome 4 at 141,841,523 bp
  • T to A, chromosome 4 at 147,941,488 bp
  • T to A, chromosome 4 at 148,562,394 bp
  • A to C, chromosome 5 at 77,332,039 bp
  • A to G, chromosome 5 at 98,872,558 bp
  • G to A, chromosome 5 at 118,000,468 bp
  • A to G, chromosome 5 at 143,472,966 bp
  • A to G, chromosome 6 at 7,682,007 bp
  • G to A, chromosome 6 at 29,484,626 bp
  • A to G, chromosome 6 at 40,921,021 bp
  • A to G, chromosome 6 at 48,650,427 bp
  • A to G, chromosome 6 at 116,695,434 bp
  • A to G, chromosome 6 at 117,871,739 bp
  • A to G, chromosome 7 at 6,570,851 bp
  • G to T, chromosome 7 at 19,531,520 bp
  • A to G, chromosome 7 at 24,918,576 bp
  • C to A, chromosome 7 at 79,092,718 bp
  • A to G, chromosome 7 at 97,310,339 bp
  • A to T, chromosome 7 at 105,180,926 bp
  • A to G, chromosome 7 at 106,824,307 bp
  • A to T, chromosome 7 at 116,137,311 bp
  • A to G, chromosome 7 at 139,679,323 bp
  • A to T, chromosome 8 at 13,142,561 bp
  • T to G, chromosome 8 at 13,476,227 bp
  • T to A, chromosome 8 at 60,526,600 bp
  • A to C, chromosome 8 at 80,733,707 bp
  • A to T, chromosome 8 at 86,631,502 bp
  • A to G, chromosome 8 at 124,556,937 bp
  • T to A, chromosome 9 at 55,544,312 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • G to T, chromosome 9 at 119,359,313 bp
  • T to C, chromosome 10 at 40,476,199 bp
  • T to C, chromosome 10 at 83,591,052 bp
  • A to G, chromosome 10 at 85,899,221 bp
  • T to C, chromosome 10 at 91,060,188 bp
  • T to C, chromosome 10 at 127,211,417 bp
  • A to C, chromosome 10 at 128,378,089 bp
  • T to C, chromosome 10 at 128,918,366 bp
  • T to C, chromosome 11 at 68,785,314 bp
  • G to T, chromosome 11 at 73,164,877 bp
  • T to A, chromosome 11 at 74,269,420 bp
  • T to C, chromosome 11 at 78,320,052 bp
  • T to C, chromosome 11 at 96,345,541 bp
  • T to A, chromosome 11 at 103,455,480 bp
  • T to C, chromosome 11 at 103,979,759 bp
  • T to A, chromosome 12 at 11,091,654 bp
  • T to C, chromosome 12 at 81,378,367 bp
  • A to G, chromosome 13 at 21,573,743 bp
  • A to G, chromosome 14 at 30,610,301 bp
  • G to T, chromosome 14 at 55,104,365 bp
  • T to A, chromosome 15 at 21,583,808 bp
  • T to C, chromosome 15 at 42,676,401 bp
  • A to G, chromosome 16 at 30,565,449 bp
  • T to C, chromosome 16 at 44,730,182 bp
  • A to G, chromosome 17 at 44,102,355 bp
  • T to C, chromosome 17 at 86,922,342 bp
  • T to A, chromosome 18 at 12,504,359 bp
  • C to A, chromosome 18 at 37,506,131 bp
  • A to G, chromosome 18 at 56,432,300 bp
  • A to T, chromosome 18 at 61,167,496 bp
  • T to C, chromosome 19 at 18,876,064 bp
  • T to A, chromosome 19 at 42,605,004 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4750 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042031-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.