Strain Name:
Stock Number:
Citation ID:
Major Collection:

Gene Information

Allele Symbol: Igsf9em1(IMPC)J (Mus musculus (mouse))
Name: immunoglobulin superfamily, member 9; endonuclease-mediated mutation 1, Jackson
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:6101173
Gene Symbol: Igsf9 (Mus musculus (mouse))
Name: immunoglobulin superfamily, member 9
Synonyms: NRT1, Dasm1
Chromosome: 1
Alteration at locus: Targeted Mutation
Monarch Initiative (Disease and Phenotype Associations): MGI:2135283
Genetic Alterations
intragenic deletion
ES Cell Line
MeSH Terms
    Strain Development
    This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTGGCCCATGACTACAAA, GAGAAACTGTATGTGCGGGA, CTGAGTTTAATTCAGCGCTG and CCAGTGTTAGGCAGTGACTG, which resulted in a 1163 bp deletion beginning at Chromosome 1 positive strand position 172,491,340 bp and ending after 172,492,502 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000361352 through ENSMUSE00000366373 (exons 7-9) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 18 amino acids later.
    Suggested Control Mice
    C57BL/6NJ or wild-type from colony
    Stephen Murray, Ph.D., The Jackson Laboratory.

    Colony and Husbandry Information

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
    Coat Color
    Overall Breeding Performance
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Undetermined Undetermined Undetermined
    Homozygotes are fertile: Undetermined Undetermined Undetermined
    Heterozygotes are fertile: Undetermined Undetermined Undetermined
    Age Reproductive Decline: Undetermined Undetermined
    Average litter size
    Average Pups Weaned

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
    042401-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
    Non-Profit / For-Profit
    Aliquot Approximate quantity2
    042401-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
    Non-Profit / For-Profit
    Litter Recovered litter1; additional fees for any special requests.

    1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.