Strain Name:
C57BL/6J-MtgxR4766Btlr/Mmmh
Stock Number:
042407-MU
Citation ID:
RRID:MMRRC_042407-MU
Other Names:
R4766 (G1), C57BL/6J-MtgxR4766Btlr
Major Collection:

Gene Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: Fltn, D0Jmb2, myosin IIA, NMHC II-A, E030044M24Rik, Myhn1, Myhn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Rps25
Name: ribosomal protein S25
Synonyms: 2810009D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75617
VEGA: 9
Homologene: 133893
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD(65), GAD65, Gad-2, 6330404F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Cd2ap
Name: CD2-associated protein
Synonyms: Mets1, METS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: NRB, neurabin-I, Neurabin I, 2810430P21Rik, A230094E16Rik, 4930518N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243725
Homologene: 14247
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Pdxdc1
Name: pyridoxal-dependent decarboxylase domain containing 1
Synonyms: 2210010A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94184
Homologene: 22858
Agpat4
Name: 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
Synonyms: 1500003P24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68262
Homologene: 69293
Cct3
Name: chaperonin containing Tcp1, subunit 3 (gamma)
Synonyms: Cctg, TriC-P5, Tcp1-rs3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12462
HGNC: HGNC:1616
Homologene: 4373
Bard1
Name: BRCA1 associated RING domain 1
Synonyms: ENSMUSG00000060893, ENSMUSG00000073653
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12021
HGNC: HGNC:952
Homologene: 400
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: D15Ertd528e, E330036L07Rik, 2310046A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223870
Homologene: 8731
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2700066K03Rik, 2810030C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329908
Homologene: 35420
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, D2Ertd145e, 6530403D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51869
Homologene: 41231
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, G630013P12Rik, TFIIIB90, TAF3B1, TFC5, Tfnr, B130055N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 544971
Homologene: 34582
M6pr
Name: mannose-6-phosphate receptor, cation dependent
Synonyms: Mpr46, CD-MPR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17113
HGNC: HGNC:6752
Homologene: 31086
Nup85
Name: nucleoporin 85
Synonyms: Pcnt1, frount
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 445007
HGNC: HGNC:8734
Homologene: 11755
Enpp3
Name: ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms: CD203c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 209558
VEGA: 10
HGNC: HGNC:3358
Homologene: 3683
Flvcr1
Name: feline leukemia virus subgroup C cellular receptor 1
Synonyms: 9630055N22Rik, Mfsd7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226844
Homologene: 56661
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: HER3, Erbb3r, Erbb-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
Adamts12
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239337
VEGA: 15
Homologene: 12808
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Mfge8
Name: milk fat globule-EGF factor 8 protein
Synonyms: Mfgm, MFG-E8, lactadherin, SED1, EGF/factor VIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17304
HGNC: HGNC:7036
Homologene: 4334
Lins1
Name: lines homolog 1
Synonyms: Wins2, 2700083B01Rik, Lins
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72635
Homologene: 10034
2900026A02Rik
Name: RIKEN cDNA 2900026A02 gene
Synonyms: Gm449, LOC231620
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243219
Homologene: 129566
Ppp1r21
Name: protein phosphatase 1, regulatory subunit 21
Synonyms: Ccdc128, 1110018J12Rik, Klraq1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 73825
Homologene: 44811
Scamp5
Name: secretory carrier membrane protein 5
Synonyms: Sc5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56807
VEGA: 9
Homologene: 56880
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234699
Homologene: 40937
Pla2g15
Name: phospholipase A2, group XV
Synonyms: C87498, Lpla2, Lypla3, LLPL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 192654
Homologene: 8200
Kdm2a
Name: lysine (K)-specific demethylase 2A
Synonyms: Gm4560, Fbl7, lalina, 5530401A10Rik, Fbxl11, Jhdm1a, Cxxc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225876
Homologene: 56564
Kcna4
Name: potassium voltage-gated channel, shaker-related subfamily, member 4
Synonyms: Kv1.4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16492
HGNC: HGNC:6222
Homologene: 20514
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: Ryr, calcium release channel isoform 1, skrr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
Slfn4
Name: schlafen 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20558
Homologene: 133236
Kcnj11
Name: potassium inwardly rectifying channel, subfamily J, member 11
Synonyms: Kir6.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16514
HGNC: HGNC:6257
Homologene: 441
Spdye4b
Name: speedy/RINGO cell cycle regulator family, member E4B
Synonyms: 4933411G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330228
Homologene: 138445
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Arsi
Name: arylsulfatase i
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 545260
Homologene: 44428
Ccdc175
Name: coiled-coil domain containing 175
Synonyms: 4930403N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 73936
VEGA: 12
Homologene: 79144
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: Wdr52, 6330444M21Rik, D16Ertd642e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212517
Homologene: 75085
Dscam
Name: DS cell adhesion molecule
Synonyms: Down syndrome cell adhesion molecule, 4932410A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
AI182371
Name: expressed sequence AI182371
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98870
Homologene: 87268
Taar2
Name: trace amine-associated receptor 2
Synonyms: Gpr58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 209512
HGNC: HGNC:4514
Homologene: 110760
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, Spacrcan, IPM200
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224224
Homologene: 9439
Tspan15
Name: tetraspanin 15
Synonyms: Tm4sf15, 2700063A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70423
VEGA: 10
Homologene: 22716
Sspo
Name: SCO-spondin
Synonyms: Scospondin, C79529
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243369
Homologene: 45453
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230806
Homologene: 19232
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17836
Homologene: 136663
Nlrp4d
Name: NLR family, pyrin domain containing 4D
Synonyms: Nalp4d, Nalp-beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384752
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: C230094A16Rik, 2900083P10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237711
Homologene: 104282
Olfr628
Name: olfactory receptor 628
Synonyms: GA_x6K02T2PBJ9-6457667-6458617, Olfr1526-ps1, MOR22-1, MOR22-4P, MOR22-4P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259159
Homologene: 8420
Krt2
Name: keratin 2
Synonyms: Krt2-2, Krt2e, Krt2-17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Olfr1298
Name: olfactory receptor 1298
Synonyms: MOR248-6, GA_x6K02T2Q125-72697413-72696475
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258888
Homologene: 121521
Man1c1
Name: mannosidase, alpha, class 1C, member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230815
Homologene: 69303
Clca3a1
Name: chloride channel accessory 3A1
Synonyms: Clca1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12722
Homologene: 77224
Fut9
Name: fucosyltransferase 9
Synonyms: mFuc-TIX, mFUT9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14348
HGNC: HGNC:4020
Homologene: 4800
Tor1a
Name: torsin family 1, member A (torsin A)
Synonyms: DQ2, torsinA, Tor1a, Dyt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 30931
HGNC: HGNC:3098
Homologene: 37263
Spag6l
Name: sperm associated antigen 6-like
Synonyms: Spag6, PF16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 50525
Homologene: 8252
Usp45
Name: ubiquitin specific petidase 45
Synonyms: 4930550B20Rik, Gcap7, 3110003C05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77593
Homologene: 17674
Ptpru
Name: protein tyrosine phosphatase, receptor type, U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Sh2b2
Name: SH2B adaptor protein 2
Synonyms: Aps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 23921
Homologene: 10309
4931428F04Rik
Name: RIKEN cDNA 4931428F04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74356
Homologene: 47588
Epha1
Name: Eph receptor A1
Synonyms: Esk, 5730453L17Rik, Eph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13835
HGNC: HGNC:3385
Homologene: 3835
Ccr8
Name: chemokine (C-C motif) receptor 8
Synonyms: Cmkbr8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12776
VEGA: 9
HGNC: HGNC:1609
Homologene: 21080
Pax5
Name: paired box 5
Synonyms: EBB-1, Pax-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18507
HGNC: HGNC:8619
Homologene: 56419
Olfr331
Name: olfactory receptor 331
Synonyms: GA_x6K02T2NKPP-912840-913784, MOR275-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100502887
Homologene: 133015
Trdn
Name: triadin
Synonyms: triadin-2, EG432451, triadin 2, triadin-3, 2310045H21Rik, triadin 3, triadin-1, triadin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Cela3a
Name: chymotrypsin-like elastase family, member 3A
Synonyms: Gm13011
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242711
Homologene: 129880
Fads3
Name: fatty acid desaturase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 60527
VEGA: 19
HGNC: HGNC:3576
Homologene: 11025
Hsd3b3
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3
Synonyms: 9030618K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 15494
Homologene: 133013
Trim56
Name: tripartite motif-containing 56
Synonyms: LOC384309, A130009K11Rik, RNF109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384309
Homologene: 12812
Capn10
Name: calpain 10
Synonyms: Capn8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23830
HGNC: HGNC:1477
Homologene: 36323
Slc26a8
Name: solute carrier family 26, member 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224661
Homologene: 27095
Ccdc9b
Name: coiled-coil domain containing 9B
Synonyms: A430105I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 214239
Homologene: 128188
Olfr844
Name: olfactory receptor 844
Synonyms: MOR153-3, GA_x6K02T2PVTD-13056760-13057689
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100503048
Iqcf3
Name: IQ motif containing F3
Synonyms: 1700012F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68265
Homologene: 86789
Gkn3
Name: gastrokine 3
Synonyms: 1190003M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68888
Homologene: 87422
Kcnmb2
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 2
Synonyms: 2700049B16Rik, 3110031N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72413
HGNC: HGNC:6286
Homologene: 4257
Apol11b
Name: apolipoprotein L 11b
Synonyms: A330102K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 328563
Homologene: 129975
Taar7e
Name: trace amine-associated receptor 7E
Synonyms: LOC276742
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 276742
Homologene: 134040
Myl7
Name: myosin, light polypeptide 7, regulatory
Synonyms: MLC-2alpha, Mylc2a, MLC2a, RLC-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17898
Homologene: 23290
Pcdha7
Name: protocadherin alpha 7
Synonyms: Cnr4, Crnr4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12939
HGNC: HGNC:8673
Homologene: 117962
Uckl1os
Name: uridine-cytidine kinase 1-like 1, opposite strand
Synonyms: Gm16119
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100271841
Gm26870
Name: predicted gene, 26870
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Gm11571
Name: predicted gene 11571
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 102635562
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 30,813,939 bp
  • T to C, chromosome 1 at 71,075,174 bp
  • T to C, chromosome 1 at 92,943,419 bp
  • T to C, chromosome 1 at 110,893,260 bp
  • A to T, chromosome 1 at 191,021,106 bp
  • C to T, chromosome 2 at 22,622,667 bp
  • C to A, chromosome 2 at 30,967,730 bp
  • T to C, chromosome 2 at 35,095,817 bp
  • T to A, chromosome 2 at 52,098,934 bp
  • G to A, chromosome 2 at 107,296,543 bp
  • T to C, chromosome 2 at 111,645,881 bp
  • C to A, chromosome 2 at 118,759,577 bp
  • T to C, chromosome 2 at 181,585,095 bp
  • T to A, chromosome 3 at 32,181,867 bp
  • T to A, chromosome 3 at 88,311,785 bp
  • A to G, chromosome 3 at 98,742,485 bp
  • A to T, chromosome 3 at 144,749,712 bp
  • A to G, chromosome 4 at 21,797,307 bp
  • A to G, chromosome 4 at 25,799,191 bp
  • T to A, chromosome 4 at 44,679,494 bp
  • A to G, chromosome 4 at 106,416,048 bp
  • A to G, chromosome 4 at 131,820,964 bp
  • A to G, chromosome 4 at 134,089,352 bp
  • G to C, chromosome 4 at 134,703,438 bp
  • A to G, chromosome 4 at 137,402,675 bp
  • C to T, chromosome 5 at 113,097,636 bp
  • T to G, chromosome 5 at 136,231,957 bp
  • C to A, chromosome 5 at 137,112,725 bp
  • T to C, chromosome 5 at 143,196,334 bp
  • A to G, chromosome 6 at 5,157,016 bp
  • C to A, chromosome 6 at 42,356,159 bp
  • G to A, chromosome 6 at 48,470,580 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • C to T, chromosome 6 at 121,884,254 bp
  • T to C, chromosome 6 at 122,313,421 bp
  • A to T, chromosome 7 at 10,362,779 bp
  • T to C, chromosome 7 at 29,085,833 bp
  • T to C, chromosome 7 at 46,099,816 bp
  • C to T, chromosome 7 at 66,710,641 bp
  • T to C, chromosome 7 at 79,134,525 bp
  • C to T, chromosome 7 at 103,732,250 bp
  • A to G, chromosome 8 at 105,281,933 bp
  • G to A, chromosome 8 at 105,887,379 bp
  • G to T, chromosome 8 at 106,163,071 bp
  • T to G, chromosome 9 at 3,038,073 bp
  • G to A, chromosome 9 at 19,318,845 bp
  • T to A, chromosome 9 at 44,408,749 bp
  • T to G, chromosome 9 at 57,452,036 bp
  • T to G, chromosome 9 at 66,441,929 bp
  • T to A, chromosome 9 at 67,878,224 bp
  • A to G, chromosome 9 at 106,560,949 bp
  • G to A, chromosome 9 at 120,094,464 bp
  • A to T, chromosome 10 at 23,940,771 bp
  • A to G, chromosome 10 at 24,038,566 bp
  • A to G, chromosome 10 at 24,773,927 bp
  • A to T, chromosome 10 at 33,474,506 bp
  • T to A, chromosome 10 at 62,191,544 bp
  • A to G, chromosome 10 at 128,586,238 bp
  • T to A, chromosome 11 at 5,898,171 bp
  • C to A, chromosome 11 at 29,805,757 bp
  • T to A, chromosome 11 at 58,501,668 bp
  • T to A, chromosome 11 at 59,012,742 bp
  • T to G, chromosome 11 at 83,186,821 bp
  • T to A, chromosome 11 at 100,084,076 bp
  • T to A, chromosome 11 at 115,577,925 bp
  • C to T, chromosome 12 at 72,112,205 bp
  • C to A, chromosome 13 at 100,049,868 bp
  • A to G, chromosome 15 at 11,285,901 bp
  • T to A, chromosome 15 at 77,634,933 bp
  • T to C, chromosome 15 at 77,807,877 bp
  • T to C, chromosome 15 at 98,045,896 bp
  • T to C, chromosome 15 at 101,813,960 bp
  • C to A, chromosome 16 at 13,838,308 bp
  • G to A, chromosome 16 at 16,777,390 bp
  • T to C, chromosome 16 at 32,769,167 bp
  • T to A, chromosome 16 at 44,415,883 bp
  • TACCACCACCACCACCACCACCACCA to TACCACCACCACCACCACCACCA, chromosome 16 at 56,257,939 bp
  • T to C, chromosome 16 at 96,643,988 bp
  • A to G, chromosome 17 at 12,151,750 bp
  • G to A, chromosome 17 at 28,638,661 bp
  • A to T, chromosome 17 at 42,852,459 bp
  • T to C, chromosome 17 at 88,572,615 bp
  • T to A, chromosome 18 at 36,974,507 bp
  • G to A, chromosome 18 at 60,916,651 bp
  • TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC to TTCCTCCTCCTCCTCTTCCTCCTCCTC, chromosome 19 at 4,324,507 bp
  • T to C, chromosome 19 at 10,056,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4766 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042407-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.