Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4766Btlr/Mmmh
Stock Number:
042407-MU
Citation ID:
RRID:MMRRC_042407-MU
Other Names:
R4766 (G1), C57BL/6J-MtgxR4766Btlr
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Rps25
Name: ribosomal protein S25
Synonyms: 2810009D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75617
VEGA: 9
Homologene: 133893
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 30,813,939 bp
  • T to C, chromosome 1 at 71,075,174 bp
  • T to C, chromosome 1 at 92,943,419 bp
  • T to C, chromosome 1 at 110,893,260 bp
  • A to T, chromosome 1 at 191,021,106 bp
  • C to T, chromosome 2 at 22,622,667 bp
  • C to A, chromosome 2 at 30,967,730 bp
  • T to C, chromosome 2 at 35,095,817 bp
  • T to A, chromosome 2 at 52,098,934 bp
  • G to A, chromosome 2 at 107,296,543 bp
  • T to C, chromosome 2 at 111,645,881 bp
  • C to A, chromosome 2 at 118,759,577 bp
  • T to C, chromosome 2 at 181,585,095 bp
  • T to A, chromosome 3 at 32,181,867 bp
  • T to A, chromosome 3 at 88,311,785 bp
  • A to G, chromosome 3 at 98,742,485 bp
  • A to T, chromosome 3 at 144,749,712 bp
  • A to G, chromosome 4 at 21,797,307 bp
  • A to G, chromosome 4 at 25,799,191 bp
  • T to A, chromosome 4 at 44,679,494 bp
  • A to G, chromosome 4 at 106,416,048 bp
  • A to G, chromosome 4 at 131,820,964 bp
  • A to G, chromosome 4 at 134,089,352 bp
  • G to C, chromosome 4 at 134,703,438 bp
  • A to G, chromosome 4 at 137,402,675 bp
  • C to T, chromosome 5 at 113,097,636 bp
  • T to G, chromosome 5 at 136,231,957 bp
  • C to A, chromosome 5 at 137,112,725 bp
  • T to C, chromosome 5 at 143,196,334 bp
  • A to G, chromosome 6 at 5,157,016 bp
  • C to A, chromosome 6 at 42,356,159 bp
  • G to A, chromosome 6 at 48,470,580 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • C to T, chromosome 6 at 121,884,254 bp
  • T to C, chromosome 6 at 122,313,421 bp
  • A to T, chromosome 7 at 10,362,779 bp
  • T to C, chromosome 7 at 29,085,833 bp
  • T to C, chromosome 7 at 46,099,816 bp
  • C to T, chromosome 7 at 66,710,641 bp
  • T to C, chromosome 7 at 79,134,525 bp
  • C to T, chromosome 7 at 103,732,250 bp
  • A to G, chromosome 8 at 105,281,933 bp
  • G to A, chromosome 8 at 105,887,379 bp
  • G to T, chromosome 8 at 106,163,071 bp
  • T to G, chromosome 9 at 3,038,073 bp
  • G to A, chromosome 9 at 19,318,845 bp
  • T to A, chromosome 9 at 44,408,749 bp
  • T to G, chromosome 9 at 57,452,036 bp
  • T to G, chromosome 9 at 66,441,929 bp
  • T to A, chromosome 9 at 67,878,224 bp
  • A to G, chromosome 9 at 106,560,949 bp
  • G to A, chromosome 9 at 120,094,464 bp
  • A to T, chromosome 10 at 23,940,771 bp
  • A to G, chromosome 10 at 24,038,566 bp
  • A to G, chromosome 10 at 24,773,927 bp
  • A to T, chromosome 10 at 33,474,506 bp
  • T to A, chromosome 10 at 62,191,544 bp
  • A to G, chromosome 10 at 128,586,238 bp
  • T to A, chromosome 11 at 5,898,171 bp
  • C to A, chromosome 11 at 29,805,757 bp
  • T to A, chromosome 11 at 58,501,668 bp
  • T to A, chromosome 11 at 59,012,742 bp
  • T to G, chromosome 11 at 83,186,821 bp
  • T to A, chromosome 11 at 100,084,076 bp
  • T to A, chromosome 11 at 115,577,925 bp
  • C to T, chromosome 12 at 72,112,205 bp
  • C to A, chromosome 13 at 100,049,868 bp
  • A to G, chromosome 15 at 11,285,901 bp
  • T to A, chromosome 15 at 77,634,933 bp
  • T to C, chromosome 15 at 77,807,877 bp
  • T to C, chromosome 15 at 98,045,896 bp
  • T to C, chromosome 15 at 101,813,960 bp
  • C to A, chromosome 16 at 13,838,308 bp
  • G to A, chromosome 16 at 16,777,390 bp
  • T to C, chromosome 16 at 32,769,167 bp
  • T to A, chromosome 16 at 44,415,883 bp
  • TACCACCACCACCACCACCACCACCA to TACCACCACCACCACCACCACCA, chromosome 16 at 56,257,939 bp
  • T to C, chromosome 16 at 96,643,988 bp
  • A to G, chromosome 17 at 12,151,750 bp
  • G to A, chromosome 17 at 28,638,661 bp
  • A to T, chromosome 17 at 42,852,459 bp
  • T to C, chromosome 17 at 88,572,615 bp
  • T to A, chromosome 18 at 36,974,507 bp
  • G to A, chromosome 18 at 60,916,651 bp
  • TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC to TTCCTCCTCCTCCTCTTCCTCCTCCTC, chromosome 19 at 4,324,507 bp
  • T to C, chromosome 19 at 10,056,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4766 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042407-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.