Strain Name:
C57BL/6J-MtgxR4773Btlr/Mmmh
Stock Number:
042411-MU
Citation ID:
RRID:MMRRC_042411-MU
Other Names:
R4773 (G1), C57BL/6J-MtgxR4773Btlr
Major Collection:

Strain Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77569
Homologene: 18953
Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 109241
Homologene: 81861
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Ece1
Name: endothelin converting enzyme 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230857
HGNC: HGNC:3146
Homologene: 1068
Adipor2
Name: adiponectin receptor 2
Synonyms: 1110001I14Rik, D6Ucla1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68465
Homologene: 56119
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243905
Homologene: 136307
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268936
Homologene: 16092
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228790
Homologene: 9098
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Ncapd2
Name: non-SMC condensin I complex, subunit D2
Synonyms: CNAP1, CAP-D2, 2810406C15Rik, 2810465G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68298
Homologene: 6497
Wwc1
Name: WW, C2 and coiled-coil domain containing 1
Synonyms: Kibra
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 211652
Homologene: 69180
Rasa2
Name: RAS p21 protein activator 2
Synonyms: GAP1m, 5430433H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 114713
HGNC: HGNC:9872
Homologene: 4745
Washc3
Name: WASH complex subunit 3
Synonyms: 5730495F03Rik, 2900091E11Rik, Ccdc53
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67282
Homologene: 9364
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20017
Homologene: 7133
Otof
Name: otoferlin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 83762
HGNC: HGNC:8515
Homologene: 12892
Sos1
Name: SOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms: 4430401P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20662
VEGA: 17
Homologene: 4117
Sqle
Name: squalene epoxidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20775
Homologene: 2355
Fcer1g
Name: Fc receptor, IgE, high affinity I, gamma polypeptide
Synonyms: FcR-gamma, FcR[g], Fce1g, Ly-50, FcRgamma, FcepsilonRI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14127
HGNC: HGNC:3611
Homologene: 3029
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Tmtc3
Name: transmembrane and tetratricopeptide repeat containing 3
Synonyms: 9130014E20Rik, B130008E12Rik, mSmile
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237500
Homologene: 27616
Glud1
Name: glutamate dehydrogenase 1
Synonyms: Gdh-X, Glud
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14661
Homologene: 55885
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: 1110034C04Rik, Smek1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Med13
Name: mediator complex subunit 13
Synonyms: Trap240, 1110067M05Rik, Thrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327987
Homologene: 21067
Lpl
Name: lipoprotein lipase
Synonyms: O 1-4-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16956
HGNC: HGNC:6677
Homologene: 200
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71685
Homologene: 56997
Pdgfa
Name: platelet derived growth factor, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18590
HGNC: HGNC:8799
Homologene: 32055
H1f3
Name: H1.3 linker histone, cluster member
Synonyms: H1.3, H1D, H1s-4, H1f3, Hist1h1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14957
HGNC: HGNC:4717
Homologene: 68456
Mettl16
Name: methyltransferase like 16
Synonyms: 2610100D03Rik, A830095F14Rik, 2810013M15Rik, Mett10d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67493
Homologene: 34653
Taf4b
Name: TATA-box binding protein associated factor 4b
Synonyms: Taf2c2, TAFII105, 105kDa, 2610524B04Rik, 4932409F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72504
VEGA: 18
Homologene: 28266
Vrk3
Name: vaccinia related kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101568
Homologene: 9509
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93889
Homologene: 137649
Soga1
Name: suppressor of glucose, autophagy associated 1
Synonyms: D430036N24Rik, 9830001H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320706
Homologene: 52382
Trpc6
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: mtrp6, Trrp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22068
VEGA: 9
Homologene: 37944
Tex15
Name: testis expressed gene 15
Synonyms: 2210014E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 104271
Homologene: 12837
Tns2
Name: tensin 2
Synonyms: nep, nph, Tenc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ccdc175
Name: coiled-coil domain containing 175
Synonyms: 4930403N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 73936
VEGA: 12
Homologene: 79144
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 192188
Homologene: 23022
Pdzd8
Name: PDZ domain containing 8
Synonyms: A630041P07Rik, Pdzk8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Tubd1
Name: tubulin, delta 1
Synonyms: 4930550G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56427
Homologene: 9443
Phkg1
Name: phosphorylase kinase gamma 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18682
HGNC: HGNC:8930
Homologene: 68508
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74407
Homologene: 12860
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
H60b
Name: histocompatibility 60b
Synonyms: EG667281
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 667281
Homologene: 120804
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212392
Homologene: 17668
Fscb
Name: fibrous sheath CABYR binding protein
Synonyms: EG623046
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 623046
VEGA: 12
Homologene: 136275
Wdr83
Name: WD repeat domain containing 83
Synonyms: 1500041N16Rik, Morg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67836
Homologene: 12194
Cyp2d40
Name: cytochrome P450, family 2, subfamily d, polypeptide 40
Synonyms: 1300013D18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 71754
VEGA: 15
HGNC: HGNC:2625
Homologene: 135470
Cby2
Name: chibby family member 2
Synonyms: 1700086N05Rik, Nurit, Spert
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67926
VEGA: 14
Homologene: 12213
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17836
Homologene: 136663
Dscc1
Name: DNA replication and sister chromatid cohesion 1
Synonyms: 2010006I05Rik, 2600005O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72107
Homologene: 5464
Flnc
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75718
Homologene: 19431
Fam111a
Name: family with sequence similarity 111, member A
Synonyms: 4632417K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107373
Homologene: 49696
Nfil3
Name: nuclear factor, interleukin 3, regulated
Synonyms: E4BP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18030
HGNC: HGNC:7787
Homologene: 3928
Tph1
Name: tryptophan hydroxylase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21990
Homologene: 121565
Vmn1r210
Name: vomeronasal 1 receptor 210
Synonyms: V1rh10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171269
Homologene: 110880
Or10j3
Name: olfactory receptor family 10 subfamily J member 3B
Synonyms: GA_x6K02SYWG4P-534-1100, GA_x6K02T2R7CC-643715-642847, MOR267-3, MOR267-3, Olfr1405-ps1, Olfr218
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258880
Homologene: 105155
Grip2
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243547
Homologene: 16327
Actl7b
Name: actin-like 7b
Synonyms: Tact1, t-actin 1, ENSMUSG00000070980
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11471
HGNC: HGNC:162
Homologene: 21330
Slfn8
Name: schlafen 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276950
Homologene: 45432
Exd2
Name: exonuclease 3'-5' domain containing 2
Synonyms: 4930539P14Rik, Exdl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 97827
VEGA: 12
Homologene: 10066
Smg9
Name: SMG9 nonsense mediated mRNA decay factor
Synonyms: N28092, 1500002O20Rik, smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71997
Homologene: 10426
Iqca1l
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231045
Homologene: 18602
Tsga10
Name: testis specific 10
Synonyms: 4933432N21Rik, Mtsga10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 211484
Homologene: 23531
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76484
Homologene: 45138
Cpeb1
Name: cytoplasmic polyadenylation element binding protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12877
Homologene: 7278
Marchf1
Name: membrane associated ring-CH-type finger 1
Synonyms: 2900024D24Rik, March1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72925
Homologene: 113749
Arhgap25
Name: Rho GTPase activating protein 25
Synonyms: A130039I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232201
Homologene: 45507
Mstn
Name: myostatin
Synonyms: Gdf8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17700
HGNC: HGNC:4223
Homologene: 3850
Tmem156
Name: transmembrane protein 156
Synonyms: LOC243025
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243025
Homologene: 49811
9230009I02Rik
Name: RIKEN cDNA 9230009I02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 619293
Vps25
Name: vacuolar protein sorting 25
Synonyms: 1110020N13Rik, D11Wsu68e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 28084
Homologene: 6303
Txnrd2
Name: thioredoxin reductase 2
Synonyms: ESTM573010, TR beta, TR3, TGR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 26462
Homologene: 4701
Sema3g
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218877
Homologene: 10602
B4galt4
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms: 9130402O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 56375
HGNC: HGNC:927
Homologene: 37848
Or51a24
Name: olfactory receptor family 51 subfamily A member 24
Synonyms: GA_x6K02T2PBJ9-6819097-6818150, MOR13-5, Olfr645
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258247
Homologene: 66155
Cct8l1
Name: chaperonin containing TCP1, subunit 8 (theta)-like 1
Synonyms: LOC242891, Gm443
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242891
Homologene: 40943
Pecr
Name: peroxisomal trans-2-enoyl-CoA reductase
Synonyms: 2400003B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 111175
Homologene: 69255
Zdhhc4
Name: zinc finger, DHHC domain containing 4
Synonyms: 2900029I10Rik, 1810021D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72881
Homologene: 10006
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 353235
Homologene: 129614
Rps11-ps4
Name: ribosomal protein S11, pseudogene 4
Synonyms: Gm9808
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100039525
Gm8126
Name: predicted gene 8126
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 108168152
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 37,835,525 bp
  • A to T, chromosome 1 at 53,062,108 bp
  • G to T, chromosome 1 at 72,267,435 bp
  • A to T, chromosome 1 at 171,231,210 bp
  • A to G, chromosome 1 at 172,105,220 bp
  • A to C, chromosome 1 at 173,204,229 bp
  • A to C, chromosome 2 at 49,274,611 bp
  • T to C, chromosome 2 at 71,822,444 bp
  • T to A, chromosome 2 at 76,741,434 bp
  • T to C, chromosome 2 at 129,105,328 bp
  • T to A, chromosome 2 at 153,401,985 bp
  • G to T, chromosome 2 at 157,030,569 bp
  • T to C, chromosome 4 at 56,740,972 bp
  • A to G, chromosome 4 at 137,945,153 bp
  • A to G, chromosome 4 at 138,581,755 bp
  • A to G, chromosome 5 at 24,550,598 bp
  • A to T, chromosome 5 at 25,517,756 bp
  • A to G, chromosome 5 at 30,394,682 bp
  • A to T, chromosome 5 at 65,080,159 bp
  • A to T, chromosome 5 at 67,027,507 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • G to T, chromosome 5 at 129,873,273 bp
  • T to C, chromosome 5 at 137,436,313 bp
  • T to C, chromosome 5 at 138,993,296 bp
  • A to T, chromosome 5 at 143,326,176 bp
  • T to C, chromosome 6 at 29,445,039 bp
  • A to G, chromosome 6 at 87,496,071 bp
  • G to A, chromosome 6 at 91,782,432 bp
  • A to G, chromosome 6 at 119,359,086 bp
  • T to A, chromosome 6 at 121,874,497 bp
  • G to A, chromosome 6 at 125,170,997 bp
  • T to A, chromosome 7 at 24,407,594 bp
  • T to A, chromosome 7 at 29,997,770 bp
  • T to A, chromosome 7 at 44,775,476 bp
  • T to C, chromosome 7 at 46,656,952 bp
  • A to T, chromosome 7 at 81,355,947 bp
  • A to G, chromosome 7 at 104,084,295 bp
  • G to A, chromosome 7 at 139,924,031 bp
  • T to C, chromosome 8 at 33,582,732 bp
  • G to A, chromosome 8 at 45,943,208 bp
  • T to A, chromosome 8 at 66,387,224 bp
  • T to A, chromosome 8 at 68,896,751 bp
  • T to A, chromosome 8 at 85,080,781 bp
  • T to A, chromosome 9 at 8,609,851 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to T, chromosome 9 at 96,544,417 bp
  • C to T, chromosome 10 at 22,288,745 bp
  • G to A, chromosome 10 at 86,907,371 bp
  • C to T, chromosome 10 at 88,219,262 bp
  • T to A, chromosome 10 at 100,457,139 bp
  • T to C, chromosome 11 at 35,867,296 bp
  • A to G, chromosome 11 at 51,091,262 bp
  • T to A, chromosome 11 at 74,817,301 bp
  • A to G, chromosome 11 at 83,017,393 bp
  • T to C, chromosome 11 at 86,276,920 bp
  • T to C, chromosome 11 at 86,555,302 bp
  • G to T, chromosome 11 at 94,411,472 bp
  • C to A, chromosome 11 at 100,549,916 bp
  • T to C, chromosome 11 at 101,258,829 bp
  • T to C, chromosome 12 at 51,297,623 bp
  • C to T, chromosome 12 at 64,473,690 bp
  • A to T, chromosome 12 at 72,136,048 bp
  • T to C, chromosome 12 at 80,475,818 bp
  • A to G, chromosome 12 at 101,082,767 bp
  • T to G, chromosome 13 at 22,827,204 bp
  • T to C, chromosome 13 at 23,555,402 bp
  • A to G, chromosome 13 at 52,968,014 bp
  • A to G, chromosome 14 at 31,220,709 bp
  • T to C, chromosome 14 at 34,321,825 bp
  • T to A, chromosome 14 at 43,261,615 bp
  • T to A, chromosome 14 at 75,583,106 bp
  • A to T, chromosome 15 at 55,080,258 bp
  • C to A, chromosome 15 at 59,317,839 bp
  • T to A, chromosome 15 at 82,761,562 bp
  • A to T, chromosome 15 at 89,166,947 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • C to G, chromosome 16 at 18,440,819 bp
  • T to A, chromosome 16 at 38,752,296 bp
  • T to G, chromosome 17 at 28,821,259 bp
  • G to A, chromosome 17 at 73,710,003 bp
  • A to G, chromosome 17 at 80,398,231 bp
  • A to G, chromosome 18 at 14,804,520 bp
  • G to T, chromosome 18 at 36,994,573 bp
  • A to G, chromosome 18 at 37,490,454 bp
  • A to T, chromosome 19 at 12,588,408 bp
  • A to T, chromosome 19 at 32,052,858 bp
  • A to G, chromosome 19 at 59,300,860 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042411-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.