Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4773Btlr/Mmmh
Stock Number:
042411-MU
Citation ID:
RRID:MMRRC_042411-MU
Other Names:
R4773 (G1), C57BL/6J-MtgxR4773Btlr
Major Collection:

Strain Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Ece1
Name: endothelin converting enzyme 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230857
HGNC: HGNC:3146
Homologene: 1068
Adipor2
Name: adiponectin receptor 2
Synonyms: 1110001I14Rik, D6Ucla1e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68465
Homologene: 56119
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 37,835,525 bp
  • A to T, chromosome 1 at 53,062,108 bp
  • G to T, chromosome 1 at 72,267,435 bp
  • A to T, chromosome 1 at 171,231,210 bp
  • A to G, chromosome 1 at 172,105,220 bp
  • A to C, chromosome 1 at 173,204,229 bp
  • A to C, chromosome 2 at 49,274,611 bp
  • T to C, chromosome 2 at 71,822,444 bp
  • T to A, chromosome 2 at 76,741,434 bp
  • T to C, chromosome 2 at 129,105,328 bp
  • T to A, chromosome 2 at 153,401,985 bp
  • G to T, chromosome 2 at 157,030,569 bp
  • T to C, chromosome 4 at 56,740,972 bp
  • A to G, chromosome 4 at 137,945,153 bp
  • A to G, chromosome 4 at 138,581,755 bp
  • A to G, chromosome 5 at 24,550,598 bp
  • A to T, chromosome 5 at 25,517,756 bp
  • A to G, chromosome 5 at 30,394,682 bp
  • A to T, chromosome 5 at 65,080,159 bp
  • A to T, chromosome 5 at 67,027,507 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • G to T, chromosome 5 at 129,873,273 bp
  • T to C, chromosome 5 at 137,436,313 bp
  • T to C, chromosome 5 at 138,993,296 bp
  • A to T, chromosome 5 at 143,326,176 bp
  • T to C, chromosome 6 at 29,445,039 bp
  • A to G, chromosome 6 at 87,496,071 bp
  • G to A, chromosome 6 at 91,782,432 bp
  • A to G, chromosome 6 at 119,359,086 bp
  • T to A, chromosome 6 at 121,874,497 bp
  • G to A, chromosome 6 at 125,170,997 bp
  • T to A, chromosome 7 at 24,407,594 bp
  • T to A, chromosome 7 at 29,997,770 bp
  • T to A, chromosome 7 at 44,775,476 bp
  • T to C, chromosome 7 at 46,656,952 bp
  • A to T, chromosome 7 at 81,355,947 bp
  • A to G, chromosome 7 at 104,084,295 bp
  • G to A, chromosome 7 at 139,924,031 bp
  • T to C, chromosome 8 at 33,582,732 bp
  • G to A, chromosome 8 at 45,943,208 bp
  • T to A, chromosome 8 at 66,387,224 bp
  • T to A, chromosome 8 at 68,896,751 bp
  • T to A, chromosome 8 at 85,080,781 bp
  • T to A, chromosome 9 at 8,609,851 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to T, chromosome 9 at 96,544,417 bp
  • C to T, chromosome 10 at 22,288,745 bp
  • G to A, chromosome 10 at 86,907,371 bp
  • C to T, chromosome 10 at 88,219,262 bp
  • T to A, chromosome 10 at 100,457,139 bp
  • T to C, chromosome 11 at 35,867,296 bp
  • A to G, chromosome 11 at 51,091,262 bp
  • T to A, chromosome 11 at 74,817,301 bp
  • A to G, chromosome 11 at 83,017,393 bp
  • T to C, chromosome 11 at 86,276,920 bp
  • T to C, chromosome 11 at 86,555,302 bp
  • G to T, chromosome 11 at 94,411,472 bp
  • C to A, chromosome 11 at 100,549,916 bp
  • T to C, chromosome 11 at 101,258,829 bp
  • T to C, chromosome 12 at 51,297,623 bp
  • C to T, chromosome 12 at 64,473,690 bp
  • A to T, chromosome 12 at 72,136,048 bp
  • T to C, chromosome 12 at 80,475,818 bp
  • A to G, chromosome 12 at 101,082,767 bp
  • T to G, chromosome 13 at 22,827,204 bp
  • T to C, chromosome 13 at 23,555,402 bp
  • A to G, chromosome 13 at 52,968,014 bp
  • A to G, chromosome 14 at 31,220,709 bp
  • T to C, chromosome 14 at 34,321,825 bp
  • T to A, chromosome 14 at 43,261,615 bp
  • T to A, chromosome 14 at 75,583,106 bp
  • A to T, chromosome 15 at 55,080,258 bp
  • C to A, chromosome 15 at 59,317,839 bp
  • T to A, chromosome 15 at 82,761,562 bp
  • A to T, chromosome 15 at 89,166,947 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • C to G, chromosome 16 at 18,440,819 bp
  • T to A, chromosome 16 at 38,752,296 bp
  • T to G, chromosome 17 at 28,821,259 bp
  • G to A, chromosome 17 at 73,710,003 bp
  • A to G, chromosome 17 at 80,398,231 bp
  • A to G, chromosome 18 at 14,804,520 bp
  • G to T, chromosome 18 at 36,994,573 bp
  • A to G, chromosome 18 at 37,490,454 bp
  • A to T, chromosome 19 at 12,588,408 bp
  • A to T, chromosome 19 at 32,052,858 bp
  • A to G, chromosome 19 at 59,300,860 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042411-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.