Strain Name:
C57BL/6J-MtgxR4939Btlr/Mmmh
Stock Number:
042538-MU
Citation ID:
RRID:MMRRC_042538-MU
Other Names:
R4939 (G1), C57BL/6J-MtgxR4939Btlr
Major Collection:

Strain Information

Cdk6
Name: cyclin dependent kinase 6
Synonyms: Crk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12571
HGNC: HGNC:1777
Homologene: 963
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: D630035I23Rik, 5430433L24Rik, TRIP8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 108829
Homologene: 3129
Secisbp2
Name: SECIS binding protein 2
Synonyms: 2810012K13Rik, SBP2, 2210413N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75420
Homologene: 11415
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Zfand6
Name: zinc finger, AN1-type domain 6
Synonyms: Awp1, Za20d3, 3110005P07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 65098
Homologene: 10372
Ranbp17
Name: RAN binding protein 17
Synonyms: 4932704E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66011
Homologene: 36409
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78244
Homologene: 6752
Skap2
Name: src family associated phosphoprotein 2
Synonyms: 2610021A10Rik, mSKAP55R, RA70, SKAP-HOM, Saps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54353
Homologene: 2919
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20133
Homologene: 806
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: rjs, D7H15F32S1, jdf2, D7H15F37S1, D15F32S1h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Clic4
Name: chloride intracellular channel 4 (mitochondrial)
Synonyms: D0Jmb3, mc3s5, mtCLIC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 29876
Homologene: 8490
Nup214
Name: nucleoporin 214
Synonyms: CAN, D2H9S46E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227720
HGNC: HGNC:8064
Homologene: 38008
Top2a
Name: topoisomerase (DNA) II alpha
Synonyms: Top-2, DNA Topoisomerase II alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21973
Homologene: 830
Mtrex
Name: Mtr4 exosome RNA helicase
Synonyms: Skiv2l2, 2610528A15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72198
VEGA: 13
Homologene: 6257
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, Tip49a, 2510009G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56505
Homologene: 37839
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: Itpr-1, opt, wblo, InsP3R type I, P400, Ip3r, Pcp1, Pcp-1, IP3R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
E2f8
Name: E2F transcription factor 8
Synonyms: 4432406C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 108961
Homologene: 11654
Kctd9
Name: potassium channel tetramerisation domain containing 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105440
Homologene: 9754
Orc3
Name: origin recognition complex, subunit 3
Synonyms: Orc3l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 50793
HGNC: HGNC:8489
Homologene: 8225
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: B130055D15Rik, 2810487N22Rik, 4632407J06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Lepr
Name: leptin receptor
Synonyms: obese-like, Obr, LEPROT, obl, Modb1, OB-RGRP, leptin receptor gene-related protein, Leprb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Hoxa3
Name: homeobox A3
Synonyms: Mo-10, Hox-1.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15400
HGNC: HGNC:5104
Homologene: 40725
Tuba1c
Name: tubulin, alpha 1C
Synonyms: Tuba6, M[a]6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22146
VEGA: 15
Homologene: 69045
Zfp408
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381410
Homologene: 11687
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 5930437A14Rik, 6720426B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, perlecan, Pcn, Plc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Haus2
Name: HAUS augmin-like complex, subunit 2
Synonyms: 1700101G24Rik, Cep27, 2410007P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66296
Homologene: 10001
Pbrm1
Name: polybromo 1
Synonyms: BAF180, 2310032M22Rik, 2610016F04Rik, Pb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66923
Homologene: 10044
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: 2010013B10Rik, A230048G03Rik, D330050P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Plvap
Name: plasmalemma vesicle associated protein
Synonyms: PV-1, MECA32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 84094
Homologene: 10578
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 5830472H07Rik, 1200017A24Rik, A130095G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Shtn1
Name: shootin 1
Synonyms: 4930506M07Rik, shootin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71653
VEGA: 19
Homologene: 41249
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: Ptpri, PTP-BL, PTPL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Kmt5b
Name: lysine methyltransferase 5B
Synonyms: Suv420h1, Suv4-20h1, C630029K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225888
Homologene: 32351
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: HL-19, LOC380889, Dnahc12, DHC3, Dnahc7l, HL19, DLP12, Hdhc3, 4921531P07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: SM2, smMHC, SM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Clcn2
Name: chloride channel, voltage-sensitive 2
Synonyms: nmf240, ClC-2, Clc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12724
HGNC: HGNC:2020
Homologene: 3213
Trappc11
Name: trafficking protein particle complex 11
Synonyms: D030016E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320714
Homologene: 11076
Ccdc73
Name: coiled-coil domain containing 73
Synonyms: 2210415I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 211936
Homologene: 52235
Mcoln2
Name: mucolipin 2
Synonyms: TRPML2, mucolipidin 2, 3300002C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68279
Homologene: 12258
Gm4981
Name: predicted gene 4981
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 245263
Homologene: 134545
Gm14340
Name: predicted gene 14340
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 676369
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269356
Homologene: 12931
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: Liprin-alpha4, LOC100042382, Gm3812, 1110008G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp9b, Nalp-delta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243874
Homologene: 18530
Vwce
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71768
VEGA: 19
Homologene: 17651
Sh3pxd2a
Name: SH3 and PX domains 2A
Synonyms: Sh3md1, 2310014D11Rik, Tks5, Fish
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14218
VEGA: 19
Homologene: 7317
Flg
Name: filaggrin
Synonyms: profilaggrin, fillagrin, ft
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14246
VEGA: 3
Atp2a1
Name: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Synonyms: SERCA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11937
HGNC: HGNC:811
Homologene: 7635
Nubpl
Name: nucleotide binding protein-like
Synonyms: 2410170E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76826
Homologene: 11854
Tas2r123
Name: taste receptor, type 2, member 123
Synonyms: STC 9-2, mt2r55, T2R23, Tas2r23, mGR23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 353167
Homologene: 45450
Rpap2
Name: RNA polymerase II associated protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231571
Homologene: 11733
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243961
Homologene: 22949
Tmem132d
Name: transmembrane protein 132D
Synonyms: C630028F04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243274
Homologene: 71684
Tgfbr3
Name: transforming growth factor, beta receptor III
Synonyms: TBRIII, 1110036H20Rik, betaglycan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21814
Homologene: 2436
Hexdc
Name: hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 238023
Homologene: 68120
Or2y17
Name: olfactory receptor family 2 subfamily Y member 17
Synonyms: MOR256-2, GA_x6K02T2QP88-6094111-6093176, Olfr1390
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259068
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: 1110035E02Rik, 1700007L07Rik, fsn, hea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225049
Homologene: 12515
Idua
Name: iduronidase, alpha-L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15932
HGNC: HGNC:5391
Homologene: 170
Sncaip
Name: synuclein, alpha interacting protein (synphilin)
Synonyms: synphilin-1, SYPH1, 4933427B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67847
Homologene: 3987
Or4d1
Name: olfactory receptor family 4 subfamily D member 1
Synonyms: GA_x6K02T2PAEV-9555122-9554181, MOR240-2, Olfr464
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258407
HGNC: HGNC:8293
Homologene: 44975
Slc5a4b
Name: solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms: SAAT1, pSGLT2, SGLT3b, 2010104G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 64454
Homologene: 56968
Poldip2
Name: polymerase (DNA-directed), delta interacting protein 2
Synonyms: mitogenin 1, 1300003F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67811
Homologene: 9201
Slc28a3
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 3
Synonyms: Cnt3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 114304
Homologene: 32533
Or10j3
Name: olfactory receptor family 10 subfamily J member 3B
Synonyms: MOR267-3, Olfr1405-ps1, GA_x6K02T2R7CC-643715-642847, MOR267-3, GA_x6K02SYWG4P-534-1100, Olfr218
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258880
Homologene: 105155
Lamc2
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16782
HGNC: HGNC:6493
Homologene: 4062
Llgl1
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16897
HGNC: HGNC:6628
Homologene: 31220
Slfn8
Name: schlafen 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276950
Homologene: 45432
Cyp4a29
Name: cytochrome P450, family 4, subfamily a, polypeptide 29
Synonyms: Cyp4a29-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230639
Zfp946
Name: zinc finger protein 946
Synonyms: 1300003B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74149
9130230L23Rik
Name: RIKEN cDNA 9130230L23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231253
Zfp647
Name: zinc finger protein 647
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239546
VEGA: 15
Homologene: 27805
Cyp4f16
Name: cytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms: 2310021J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 70101
Homologene: 135840
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: Pdeb, rd, r, rd10, rd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Utp11
Name: UTP11 small subunit processome component
Synonyms: Utp11l, 2700082D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67205
Homologene: 6349
Or2t46
Name: olfactory receptor family 2 subfamily T member 46
Synonyms: MOR275-11_p, MOR275-5, GA_x6K02T2NKPP-844642-843680, Olfr325
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258261
Homologene: 133015
Celf3
Name: CUGBP, Elav-like family member 3
Synonyms: 4930415M08Rik, Tnrc4, CAGH4, ERDA4, BRUNOL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 78784
Homologene: 48510
Or5b3
Name: olfactory receptor family 5 subfamily B member 3
Synonyms: GA_x6K02T2RE5P-3743369-3744289, Olfr1469, MOR202-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258690
HGNC: HGNC:8324
Homologene: 133675
Lim2
Name: lens intrinsic membrane protein 2
Synonyms: 19kDa, MP19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233187
Homologene: 12744
Grap
Name: GRB2-related adaptor protein
Synonyms: 8430435N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71520
Homologene: 4822
Trafd1
Name: TRAF type zinc finger domain containing 1
Synonyms: Fln29, 1110008K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231712
Homologene: 31399
Vmn1r159
Name: vomeronasal 1 receptor 159
Synonyms: Gm16507
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 670857
Homologene: 104166
Or52z14
Name: olfactory receptor family 52 subfamily Z member 14
Synonyms: MOR31-5, Olfr619, GA_x6K02T2PBJ9-6326488-6327450
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259080
Homologene: 45095
Glyatl3
Name: glycine-N-acyltransferase-like 3
Synonyms: Gm5683
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 435528
VEGA: 17
Homologene: 19824
Dnaaf3
Name: dynein, axonemal assembly factor 3
Synonyms: 6030429G01Rik, b2b1739Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 436022
Homologene: 16205
C1ql4
Name: complement component 1, q subcomponent-like 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239659
VEGA: 15
Homologene: 19354
Spopfm2
Name: speckle-type BTB/POZ protein family member 2
Synonyms: Gm10696
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 100043188
Homologene: 128308
Gm28417
Name: predicted gene 28417
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 118567734
Gm12758
Name: predicted gene 12758
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100126229
Gm15614
Name: predicted gene 15614
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 102640951
Gm17197
Name: predicted gene 17197
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 102634685
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,471,617 bp
  • A to T, chromosome 1 at 134,328,079 bp
  • T to C, chromosome 1 at 153,126,836 bp
  • T to C, chromosome 1 at 173,203,463 bp
  • C to A, chromosome 2 at 31,983,159 bp
  • A to T, chromosome 2 at 91,645,105 bp
  • A to G, chromosome 2 at 104,992,157 bp
  • T to A, chromosome 2 at 120,619,036 bp
  • A to G, chromosome 2 at 130,684,868 bp
  • G to A, chromosome 2 at 180,819,822 bp
  • A to G, chromosome 3 at 93,279,847 bp
  • A to T, chromosome 3 at 94,176,233 bp
  • ACAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCA, chromosome 3 at 94,488,230 bp
  • A to T, chromosome 3 at 146,192,241 bp
  • G to A, chromosome 4 at 34,593,126 bp
  • A to T, chromosome 4 at 86,243,725 bp
  • A to T, chromosome 4 at 101,733,438 bp
  • G to A, chromosome 4 at 115,247,676 bp
  • T to G, chromosome 4 at 124,683,250 bp
  • T to C, chromosome 4 at 135,223,541 bp
  • A to T, chromosome 4 at 137,508,031 bp
  • A to T, chromosome 5 at 3,344,377 bp
  • T to C, chromosome 5 at 32,645,113 bp
  • C to T, chromosome 5 at 65,989,912 bp
  • T to G, chromosome 5 at 103,517,469 bp
  • T to C, chromosome 5 at 107,130,469 bp
  • G to T, chromosome 5 at 107,603,625 bp
  • A to G, chromosome 5 at 108,421,497 bp
  • T to C, chromosome 5 at 108,680,470 bp
  • T to G, chromosome 5 at 110,295,331 bp
  • A to G, chromosome 5 at 121,375,191 bp
  • A to T, chromosome 5 at 127,796,075 bp
  • T to C, chromosome 6 at 32,165,762 bp
  • T to A, chromosome 6 at 51,922,323 bp
  • T to C, chromosome 6 at 52,170,676 bp
  • A to G, chromosome 6 at 88,483,039 bp
  • T to A, chromosome 6 at 108,440,558 bp
  • T to C, chromosome 6 at 132,847,845 bp
  • A to T, chromosome 7 at 4,527,145 bp
  • G to T, chromosome 7 at 20,024,496 bp
  • T to G, chromosome 7 at 22,842,891 bp
  • T to A, chromosome 7 at 34,238,890 bp
  • A to G, chromosome 7 at 43,428,461 bp
  • C to T, chromosome 7 at 44,326,162 bp
  • A to T, chromosome 7 at 48,872,138 bp
  • A to G, chromosome 7 at 56,206,736 bp
  • A to C, chromosome 7 at 84,615,822 bp
  • T to C, chromosome 7 at 102,466,924 bp
  • T to C, chromosome 7 at 103,604,251 bp
  • T to C, chromosome 7 at 126,450,116 bp
  • G to A, chromosome 8 at 47,519,665 bp
  • A to G, chromosome 8 at 71,511,439 bp
  • T to C, chromosome 9 at 27,063,869 bp
  • T to C, chromosome 10 at 58,235,603 bp
  • T to A, chromosome 10 at 67,246,137 bp
  • T to C, chromosome 10 at 76,081,467 bp
  • T to C, chromosome 11 at 33,219,223 bp
  • A to G, chromosome 11 at 49,340,549 bp
  • G to T, chromosome 11 at 58,581,211 bp
  • A to T, chromosome 11 at 60,709,979 bp
  • A to G, chromosome 11 at 61,660,298 bp
  • T to C, chromosome 11 at 78,519,316 bp
  • C to T, chromosome 11 at 83,003,285 bp
  • G to T, chromosome 11 at 87,914,124 bp
  • T to A, chromosome 11 at 99,010,092 bp
  • A to G, chromosome 11 at 101,508,050 bp
  • A to T, chromosome 11 at 121,207,716 bp
  • A to G, chromosome 12 at 52,181,095 bp
  • A to T, chromosome 13 at 51,682,070 bp
  • A to C, chromosome 13 at 58,558,581 bp
  • T to C, chromosome 13 at 112,909,892 bp
  • A to T, chromosome 14 at 26,891,524 bp
  • A to G, chromosome 14 at 31,061,623 bp
  • A to G, chromosome 14 at 67,729,686 bp
  • T to A, chromosome 15 at 10,449,597 bp
  • TGCACG to TGCACGCACG, chromosome 15 at 76,911,044 bp
  • A to G, chromosome 15 at 85,820,283 bp
  • A to G, chromosome 15 at 99,037,954 bp
  • A to T, chromosome 15 at 99,087,640 bp
  • T to A, chromosome 16 at 14,239,507 bp
  • T to A, chromosome 16 at 16,140,746 bp
  • A to G, chromosome 16 at 20,712,584 bp
  • T to C, chromosome 17 at 22,455,437 bp
  • G to T, chromosome 17 at 32,537,049 bp
  • A to G, chromosome 17 at 40,910,023 bp
  • T to C, chromosome 17 at 78,762,260 bp
  • T to C, chromosome 17 at 87,330,048 bp
  • A to T, chromosome 18 at 52,907,263 bp
  • A to C, chromosome 19 at 3,815,245 bp
  • A to T, chromosome 19 at 10,645,050 bp
  • T to A, chromosome 19 at 13,410,855 bp
  • A to T, chromosome 19 at 25,122,400 bp
  • A to G, chromosome 19 at 47,278,404 bp
  • A to G, chromosome 19 at 56,364,337 bp
  • T to C, chromosome 19 at 59,022,201 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4939 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042538-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.