Strain Name:
C57BL/6J-MtgxR5056Btlr/Mmmh
Stock Number:
042646-MU
Citation ID:
RRID:MMRRC_042646-MU
Other Names:
R5056 (G1), C57BL/6J-MtgxR5056Btlr
Major Collection:

Gene Information

Adora2a
Name: adenosine A2a receptor
Synonyms: A2AAR, ARA2A, A2aR, AA2AR, A2a, Rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11540
VEGA: 10
HGNC: HGNC:263
Homologene: 20166
Trib2
Name: tribbles pseudokinase 2
Synonyms: TRB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217410
Homologene: 41445
Sfrp1
Name: secreted frizzled-related protein 1
Synonyms: sFRP-1, 2210415K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20377
Homologene: 2266
Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54445
Homologene: 41325
Nup188
Name: nucleoporin 188
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227699
Homologene: 45683
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 60611
Homologene: 10187
Wfs1
Name: wolframin ER transmembrane glycoprotein
Synonyms: Wolfram syndrome 1 homolog (human), wolframin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22393
Homologene: 4380
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 2900074J03Rik, 6430526O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237898
Homologene: 13066
Lrch4
Name: leucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms: 2810008P14Rik, 2900069C24Rik, LRN, SAP25, LRRN4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231798
HGNC: HGNC:6691
Homologene: 20532
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Cluh
Name: clustered mitochondria (cluA/CLU1) homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74148
Homologene: 9063
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: SMN2, Tg(SMN2)89Ahmb, E130018M02Rik, Gpr1g, 6330570A01Rik, mGluR7, mGlu7a receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Rnf14
Name: ring finger protein 14
Synonyms: D18Ertd188e, Triad2, 2310075C09Rik, D7Bwg0165e, 2610005D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 56736
VEGA: 18
Homologene: 129170
Med13
Name: mediator complex subunit 13
Synonyms: Thrap1, 1110067M05Rik, Trap240
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327987
Homologene: 21067
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: 1110030C19Rik, LTRPC4, TRPM4B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68667
Homologene: 23033
Dmkn
Name: dermokine
Synonyms: dermokine, Dmkn, sk89, sk30, cI-36, 1110014F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73712
Homologene: 136295
Hspa9
Name: heat shock protein 9
Synonyms: mortalin, Hsc74, Hsp74a, Hsp74, Hspa9a, mot-2, mthsp70, GRP75, PBP74, C3H-specific antigen, CSA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 15526
HGNC: HGNC:5244
Homologene: 39452
Ppp3ca
Name: protein phosphatase 3, catalytic subunit, alpha isoform
Synonyms: Caln, CnA, CN, 2900074D19Rik, PP2B alpha 1, Calna, PP2BA alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19055
HGNC: HGNC:9314
Homologene: 55497
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Epithin, Prss14, matriptase, Tmprss14, MT-SP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19143
Homologene: 7906
Mettl16
Name: methyltransferase like 16
Synonyms: Mett10d, 2610100D03Rik, A830095F14Rik, 2810013M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67493
Homologene: 34653
Sil1
Name: endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)
Synonyms: 1810057E01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 81500
VEGA: 18
Homologene: 32544
Agap3
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Synonyms: MRIP-1, Crag, Centg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 213990
Homologene: 23742
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74144
Homologene: 10397
Wif1
Name: Wnt inhibitory factor 1
Synonyms: WIF-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 24117
Homologene: 31430
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 9530009M10Rik, 1810037O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Cmtr1
Name: cap methyltransferase 1
Synonyms: Ftsjd2, 1300018I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74157
Homologene: 9003
Zfp808
Name: zinc finger protein 808
Synonyms: Gm7036
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 630579
Homologene: 134631
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Ogfrl1
Name: opioid growth factor receptor-like 1
Synonyms: 2210417C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 70155
Homologene: 11595
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668940
Homologene: 66117
9930021J03Rik
Name: RIKEN cDNA 9930021J03 gene
Synonyms: Gm9832
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240613
Homologene: 19046
Map6
Name: microtubule-associated protein 6
Synonyms: F-STOP, 2810411E12Rik, STOP, Mtap6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17760
HGNC: HGNC:6868
Homologene: 7850
Mbd6
Name: methyl-CpG binding domain protein 6
Synonyms: D10Wsu93e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 110962
Homologene: 14171
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: b2b1304Clo, b2b2025.1Clo, prh, 4921507O14Rik, D3Ertd789e, b2b1735Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 51938
Homologene: 12149
Tbc1d9
Name: TBC1 domain family, member 9
Synonyms: 4933431N12Rik, C76116
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 71310
Homologene: 57079
Trnau1ap
Name: tRNA selenocysteine 1 associated protein 1
Synonyms: Trspap1, SECp43, 1110007F05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 71787
Homologene: 49509
Olfr1025-ps1
Name: olfactory receptor 1025, pseudogene 1
Synonyms: MOR196-6_p, GA_x6K02T2Q125-47397266-47398205, MOR196-5P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258083
Bbs10
Name: Bardet-Biedl syndrome 10 (human)
Synonyms: 1300007O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71769
VEGA: 10
Homologene: 49781
Prdm9
Name: PR domain containing 9
Synonyms: Rcr1, Meisetz, repro7, Dsbc1, G1-419-29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213389
Homologene: 104139
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Cenpb
Name: centromere protein B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12616
HGNC: HGNC:1852
Homologene: 1370
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 626596
Homologene: 75047
Aldh18a1
Name: aldehyde dehydrogenase 18 family, member A1
Synonyms: Pycs, 2810433K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56454
HGNC: HGNC:9722
Homologene: 2142
Apc2
Name: APC regulator of WNT signaling pathway 2
Synonyms: APCL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 23805
Homologene: 4299
Tmem67
Name: transmembrane protein 67
Synonyms: b2b1291.1Clo, b2b1163.1Clo, 5330408M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329795
Homologene: 71886
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Zfp109
Name: zinc finger protein 109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56869
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: 4732473B16Rik, Fam46b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100342
Homologene: 24928
Kcna7
Name: potassium voltage-gated channel, shaker-related subfamily, member 7
Synonyms: Kv1.7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16495
HGNC: HGNC:6226
Homologene: 7791
Chil6
Name: chitinase-like 6
Synonyms: BC051070, BYm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229688
Homologene: 77638
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930589M24Rik, 4930438C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 75906
Homologene: 11600
Olfr1154
Name: olfactory receptor 1154
Synonyms: GA_x6K02T2Q125-49403456-49402524, MOR173-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258641
Homologene: 74192
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd10, r, Pdeb, rd1, rd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, Kv4.3, potassium channel Kv4.3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Klhdc8b
Name: kelch domain containing 8B
Synonyms: 4931406O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78267
Homologene: 45463
Pafah1b3
Name: platelet-activating factor acetylhydrolase, isoform 1b, subunit 3
Synonyms: mus[g], Pafahg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18476
HGNC: HGNC:8576
Homologene: 1933
Asic2
Name: acid-sensing (proton-gated) ion channel 2
Synonyms: Mdeg, BNC1, Accn1, BNaC1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11418
HGNC: HGNC:99
Homologene: 137202
Olfr685
Name: olfactory receptor 685
Synonyms: GA_x6K02T2PBJ9-7810071-7809121, MOR37-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258160
Homologene: 66455
Sgms1
Name: sphingomyelin synthase 1
Synonyms: 9530058O11Rik, Tmem23, SMS1alpha1, SMS1alpha2, SMS1beta, SMS1gamma, SMS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 208449
Homologene: 27040
1700030J22Rik
Name: RIKEN cDNA 1700030J22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69528
Homologene: 51842
Zpbp
Name: zona pellucida binding protein
Synonyms: Sp38, 4930486K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53604
Homologene: 5092
C87414
Name: expressed sequence C87414
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381654
Homologene: 133100
Olfr1083-ps
Name: olfactory receptor 1083, pseudogene
Synonyms: GA_x6K02T2Q125-48092599-48091658, MOR191-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 404326
Vmn2r48
Name: vomeronasal 2, receptor 48
Synonyms: EG625580
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 625580
Homologene: 113703
Gm14176
Name: predicted gene 14176
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100043681
4930483K19Rik
Name: RIKEN cDNA 4930483K19 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74953
Mir5101
Name: microRNA 5101
Synonyms: mmu-mir-5101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100628610
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 23,379,049 bp
  • G to T, chromosome 1 at 104,953,997 bp
  • A to T, chromosome 1 at 134,834,392 bp
  • G to T, chromosome 1 at 134,955,733 bp
  • A to T, chromosome 1 at 164,192,032 bp
  • T to A, chromosome 2 at 30,304,131 bp
  • T to A, chromosome 2 at 85,918,136 bp
  • T to A, chromosome 2 at 86,607,020 bp
  • T to C, chromosome 2 at 87,903,571 bp
  • C to T, chromosome 2 at 131,178,171 bp
  • G to C, chromosome 2 at 155,632,373 bp
  • T to C, chromosome 2 at 157,901,947 bp
  • C to T, chromosome 3 at 33,813,155 bp
  • T to A, chromosome 3 at 105,666,928 bp
  • T to A, chromosome 3 at 106,394,343 bp
  • C to T, chromosome 3 at 136,881,532 bp
  • T to C, chromosome 4 at 12,070,471 bp
  • T to C, chromosome 4 at 132,327,171 bp
  • C to T, chromosome 4 at 133,480,438 bp
  • T to C, chromosome 5 at 24,477,862 bp
  • T to C, chromosome 5 at 36,975,587 bp
  • T to C, chromosome 5 at 93,638,925 bp
  • A to T, chromosome 5 at 108,423,491 bp
  • C to G, chromosome 5 at 137,636,851 bp
  • A to G, chromosome 6 at 111,080,443 bp
  • A to G, chromosome 6 at 122,833,874 bp
  • T to A, chromosome 7 at 9,942,324 bp
  • T to C, chromosome 7 at 24,228,737 bp
  • C to T, chromosome 7 at 25,295,339 bp
  • T to C, chromosome 7 at 30,764,104 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 45,308,630 bp
  • G to A, chromosome 7 at 45,406,591 bp
  • T to C, chromosome 7 at 99,336,652 bp
  • T to A, chromosome 7 at 105,180,572 bp
  • A to G, chromosome 7 at 120,020,946 bp
  • T to A, chromosome 8 at 23,417,404 bp
  • T to C, chromosome 8 at 83,269,206 bp
  • T to C, chromosome 8 at 95,741,008 bp
  • T to A, chromosome 8 at 116,971,682 bp
  • A to G, chromosome 9 at 31,097,551 bp
  • T to C, chromosome 9 at 37,404,806 bp
  • ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC to ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC, chromosome 9 at 108,448,985 bp
  • A to T, chromosome 10 at 53,674,574 bp
  • T to A, chromosome 10 at 75,326,158 bp
  • T to G, chromosome 10 at 76,552,926 bp
  • T to C, chromosome 10 at 80,301,314 bp
  • C to T, chromosome 10 at 111,300,540 bp
  • A to T, chromosome 10 at 121,099,779 bp
  • C to T, chromosome 10 at 127,286,441 bp
  • T to C, chromosome 11 at 11,459,734 bp
  • C to T, chromosome 11 at 74,661,946 bp
  • T to A, chromosome 11 at 74,816,940 bp
  • T to A, chromosome 11 at 80,971,603 bp
  • A to G, chromosome 11 at 85,026,795 bp
  • A to T, chromosome 11 at 86,328,565 bp
  • C to A, chromosome 12 at 15,793,794 bp
  • A to G, chromosome 12 at 75,909,131 bp
  • T to A, chromosome 13 at 62,172,630 bp
  • A to T, chromosome 15 at 36,050,245 bp
  • T to C, chromosome 17 at 15,562,417 bp
  • A to G, chromosome 17 at 29,690,328 bp
  • A to T, chromosome 18 at 20,050,142 bp
  • A to G, chromosome 18 at 34,938,681 bp
  • T to C, chromosome 18 at 35,269,702 bp
  • C to T, chromosome 18 at 38,308,388 bp
  • T to C, chromosome 18 at 49,870,923 bp
  • A to G, chromosome 19 at 3,942,762 bp
  • A to T, chromosome 19 at 29,717,359 bp
  • A to G, chromosome 19 at 32,159,687 bp
  • G to A, chromosome 19 at 40,574,262 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5056 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042646-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.