Strain Name:
C57BL/6J-MtgxR5097Btlr/Mmmh
Stock Number:
042686-MU
Citation ID:
RRID:MMRRC_042686-MU
Other Names:
R5097 (G1), C57BL/6J-MtgxR5097Btlr
Major Collection:

Strain Information

Mitf
Name: melanogenesis associated transcription factor
Synonyms: BCC2, mi, wh, Gsfbcc2, bHLHe32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17342
HGNC: HGNC:7105
Homologene: 4892
Zfp143
Name: zinc finger protein 143
Synonyms: pHZ-1, D7Ertd805e, Zfp79, Staf, Zfp80-rs1, KRAB14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20841
Homologene: 56444
Sesn2
Name: sestrin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230784
Homologene: 12873
Otx1
Name: orthodenticle homeobox 1
Synonyms: A730044F23Rik, jv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18423
HGNC: HGNC:8521
Homologene: 7875
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: G430090F17Rik, LOC328902
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 64291
Homologene: 84746
Ireb2
Name: iron responsive element binding protein 2
Synonyms: D9Ertd85e, Irp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 4833414K03Rik, TRP-PLIK, CHAK, CHAK1, 2310022G15Rik, LTRPC7, Ltpr7, 5033407O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 58800
Homologene: 9774
Atp5f1c
Name: ATP synthase F1 subunit gamma
Synonyms: Atp5c1, F1 gamma, 1700094F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11949
HGNC: HGNC:833
Homologene: 3792
Zfp292
Name: zinc finger protein 292
Synonyms: Zn-16, 5730450D02Rik, Zn-15, Zfp15, 9430062L07Rik, Zfp-15, Krox-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 30046
Homologene: 8493
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Ndc1
Name: NDC1 transmembrane nucleoporin
Synonyms: sks, 2810475A17Rik, Tmem48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72787
Homologene: 41224
N4bp2
Name: NEDD4 binding protein 2
Synonyms: LOC333789, LOC386488, B3bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 333789
Homologene: 32396
Tsen2
Name: tRNA splicing endonuclease subunit 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381802
Homologene: 41622
Peg3
Name: paternally expressed 3
Synonyms: Zfp102, Pw1, End4, Gcap4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Mpzl1
Name: myelin protein zero-like 1
Synonyms: 1110007A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68481
HGNC: HGNC:7226
Homologene: 2939
Ppa1
Name: pyrophosphatase (inorganic) 1
Synonyms: 2010317E03Rik, Pyp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67895
HGNC: HGNC:9226
Homologene: 5356
Noc4l
Name: NOC4 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100608
Homologene: 40545
Otop1
Name: otopetrin 1
Synonyms: tlt, A530025J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21906
Homologene: 35244
Fat2
Name: FAT atypical cadherin 2
Synonyms: EMI2, mKIAA0811, Fath2, LOC245827
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 674895
Homologene: 130947
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: SM2, smMHC, SM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Eif3f
Name: eukaryotic translation initiation factor 3, subunit F
Synonyms: Eif3s5, 0610037M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 66085
HGNC: HGNC:3275
Homologene: 2783
Nprl2
Name: NPR2 like, GATOR1 complex subunit
Synonyms: NPRL2, 2810446G01Rik, NPR2L, G21, Tusc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56032
Homologene: 4771
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Ccser1
Name: coiled-coil serine rich 1
Synonyms: Fam190a, 6230405M12Rik, C130092O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232035
Homologene: 28086
Syt11
Name: synaptotagmin XI
Synonyms: 6530420C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229521
Homologene: 23120
Adamts3
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms: 1100001H14Rik, 6330442E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: MJAM, Anr1, 5830414C08Rik, Slc21a11, OATP-D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 108116
Homologene: 40862
Dis3l
Name: DIS3 like exosome 3'-5' exoribonuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 213550
Homologene: 15797
Micall1
Name: microtubule associated monooxygenase, calponin and LIM domain containing -like 1
Synonyms: D15N2e, Mus EST 820961, D15Mit260
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 27008
VEGA: 15
Homologene: 24911
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 435626
Homologene: 52359
Rfc4
Name: replication factor C (activator 1) 4
Synonyms: RFC37, A1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106344
HGNC: HGNC:9972
Homologene: 6288
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: C130038G02Rik, 5730592G18Rik, A730013O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77521
Homologene: 78141
Akt3
Name: thymoma viral proto-oncogene 3
Synonyms: PKB gamma, D930002M15Rik, Nmf350
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23797
HGNC: HGNC:393
Homologene: 55904
Myrfl
Name: myelin regulatory factor-like
Synonyms: Gm239, LOC237558
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237558
VEGA: 10
Homologene: 88588
Cttnbp2
Name: cortactin binding protein 2
Synonyms: 4732477G22Rik, 3010022N24Rik, Cortbp2, 9130022E09Rik, ORF4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30785
Homologene: 14125
Trim47
Name: tripartite motif-containing 47
Synonyms: 2210023F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217333
Homologene: 14128
Arhgef40
Name: Rho guanine nucleotide exchange factor (GEF) 40
Synonyms: E130112L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268739
Homologene: 19560
Or13a19
Name: olfactory receptor family 13 subfamily A member 19
Synonyms: GA_x6K02T2PBJ9-42472898-42473827, Olfr525, MOR251-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258958
Homologene: 138321
Evi5l
Name: ecotropic viral integration site 5 like
Synonyms: 1700084G18Rik, 3110007G05Rik, B130050I23Rik, 2310039H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 213027
Homologene: 134635
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Or6n2
Name: olfactory receptor family 6 subfamily N member 2
Synonyms: MOR105-5P, Olfr430, GA_x6K02T2P20D-21108443-21107490
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258713
Homologene: 17362
Tas2r115
Name: taste receptor, type 2, member 115
Synonyms: T2R15, mt2r49, mGR15, Tas2r15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 353325
Clgn
Name: calmegin
Synonyms: calnexin-t, 4930459O04Rik, A2/6, Cln
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12745
HGNC: HGNC:2060
Homologene: 68392
Ak5
Name: adenylate kinase 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229949
HGNC: HGNC:365
Homologene: 76103
Tmem115
Name: transmembrane protein 115
Synonyms: Pl6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56395
Homologene: 135207
Or1e16
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: Olfr1, MOR135-13, GA_x6K02T2P1NL-3556334-3555390, I54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258923
Homologene: 115482
Ftdc1
Name: ferritin domain containing 1
Synonyms: LOC385656, LOC328695, Gm813
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 328695
VEGA: 16
Rpl3l
Name: ribosomal protein L3-like
Synonyms: 1110057H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66211
Homologene: 68434
4933431E20Rik
Name: RIKEN cDNA 4933431E20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329735
Igkv4-80
Name: immunoglobulin kappa variable 4-80
Synonyms: Gm16729
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545848
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 25,826,084 bp
  • T to C, chromosome 1 at 74,147,663 bp
  • A to G, chromosome 1 at 165,605,716 bp
  • C to T, chromosome 1 at 174,069,529 bp
  • C to G, chromosome 1 at 177,248,688 bp
  • A to G, chromosome 2 at 10,063,512 bp
  • A to G, chromosome 2 at 82,991,985 bp
  • A to T, chromosome 2 at 126,796,336 bp
  • C to T, chromosome 3 at 88,747,924 bp
  • A to T, chromosome 3 at 107,895,942 bp
  • G to A, chromosome 3 at 107,895,943 bp
  • A to G, chromosome 3 at 152,481,633 bp
  • T to C, chromosome 4 at 34,839,878 bp
  • T to A, chromosome 4 at 107,374,161 bp
  • C to T, chromosome 4 at 132,496,898 bp
  • T to C, chromosome 5 at 38,302,753 bp
  • T to C, chromosome 5 at 65,817,218 bp
  • C to A, chromosome 5 at 89,693,050 bp
  • C to T, chromosome 5 at 110,651,346 bp
  • G to A, chromosome 5 at 148,295,582 bp
  • A to G, chromosome 6 at 18,434,772 bp
  • A to G, chromosome 6 at 61,312,160 bp
  • A to C, chromosome 6 at 69,016,665 bp
  • C to T, chromosome 6 at 97,996,462 bp
  • T to C, chromosome 6 at 115,547,829 bp
  • A to C, chromosome 6 at 132,737,253 bp
  • C to T, chromosome 7 at 6,710,027 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • G to A, chromosome 7 at 74,504,424 bp
  • A to T, chromosome 7 at 108,940,315 bp
  • A to G, chromosome 7 at 110,088,791 bp
  • A to G, chromosome 7 at 140,323,095 bp
  • A to G, chromosome 8 at 4,193,317 bp
  • G to T, chromosome 8 at 83,410,523 bp
  • A to G, chromosome 9 at 54,895,384 bp
  • T to A, chromosome 9 at 64,319,216 bp
  • G to A, chromosome 9 at 107,534,860 bp
  • A to G, chromosome 9 at 107,543,532 bp
  • CTAATTAATTAATTAATTAATTAATTAATT to CTAATTAATTAATTAATTAATTAATT, chromosome 10 at 61,651,657 bp
  • A to G, chromosome 10 at 116,817,704 bp
  • C to A, chromosome 11 at 21,997,037 bp
  • A to G, chromosome 11 at 55,310,704 bp
  • G to C, chromosome 11 at 73,395,293 bp
  • A to G, chromosome 11 at 116,106,434 bp
  • G to A, chromosome 11 at 120,808,455 bp
  • T to A, chromosome 14 at 14,857,851 bp
  • A to C, chromosome 14 at 51,989,689 bp
  • A to G, chromosome 15 at 79,129,878 bp
  • C to T, chromosome 16 at 14,205,906 bp
  • A to G, chromosome 16 at 23,114,296 bp
  • A to C, chromosome 16 at 58,613,864 bp
  • T to A, chromosome 17 at 24,733,461 bp
  • T to C, chromosome 18 at 12,763,537 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5097 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042686-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.