Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5137Btlr/Mmmh
Stock Number:
042723-MU
Citation ID:
RRID:MMRRC_042723-MU
Other Names:
R5137 (G1), C57BL/6J-MtgxR5137Btlr
Major Collection:

Strain Information

Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Omd
Name: osteomodulin
Synonyms: osteoadherin, SLRR2C, OSAD
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27047
VEGA: 13
HGNC: HGNC:8134
Homologene: 3677
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Zfp384
Name: zinc finger protein 384
Synonyms: C130073D16Rik, Ciz, Nmp4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269800
Homologene: 15849
B3galnt1
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
Synonyms: Mbrn 1, Brainiac 1, Globoside blood group, B3galt3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26879
HGNC: HGNC:918
Homologene: 32457
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 22,288,620 bp
  • A to G, chromosome 1 at 36,692,429 bp
  • A to T, chromosome 1 at 40,450,125 bp
  • T to A, chromosome 1 at 84,912,597 bp
  • T to A, chromosome 1 at 118,855,503 bp
  • T to C, chromosome 2 at 3,225,389 bp
  • T to C, chromosome 2 at 69,973,335 bp
  • T to G, chromosome 2 at 71,883,569 bp
  • T to G, chromosome 2 at 84,802,876 bp
  • C to A, chromosome 2 at 89,170,400 bp
  • T to C, chromosome 2 at 90,469,648 bp
  • T to G, chromosome 2 at 117,163,571 bp
  • T to A, chromosome 2 at 120,022,181 bp
  • C to T, chromosome 2 at 131,081,344 bp
  • T to C, chromosome 2 at 165,731,628 bp
  • A to T, chromosome 2 at 181,854,994 bp
  • T to C, chromosome 3 at 36,069,771 bp
  • G to T, chromosome 3 at 69,574,949 bp
  • T to C, chromosome 3 at 133,476,565 bp
  • T to C, chromosome 3 at 138,422,235 bp
  • T to A, chromosome 3 at 157,016,196 bp
  • A to G, chromosome 4 at 11,546,297 bp
  • A to T, chromosome 4 at 34,029,095 bp
  • A to T, chromosome 4 at 103,214,781 bp
  • T to A, chromosome 4 at 143,949,120 bp
  • T to C, chromosome 4 at 148,622,037 bp
  • T to A, chromosome 4 at 152,045,971 bp
  • C to T, chromosome 5 at 21,955,181 bp
  • T to C, chromosome 5 at 117,905,313 bp
  • C to T, chromosome 5 at 139,181,460 bp
  • A to T, chromosome 6 at 47,532,080 bp
  • A to G, chromosome 6 at 120,755,517 bp
  • ACAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGC, chromosome 6 at 125,036,509 bp
  • A to T, chromosome 6 at 126,533,983 bp
  • T to A, chromosome 6 at 135,116,033 bp
  • T to C, chromosome 7 at 29,101,858 bp
  • T to C, chromosome 7 at 41,042,894 bp
  • A to G, chromosome 7 at 103,451,712 bp
  • C to A, chromosome 7 at 103,451,713 bp
  • G to A, chromosome 7 at 120,885,422 bp
  • C to A, chromosome 7 at 120,885,423 bp
  • A to G, chromosome 8 at 73,048,309 bp
  • A to T, chromosome 8 at 119,625,878 bp
  • G to T, chromosome 8 at 124,694,935 bp
  • A to G, chromosome 9 at 66,448,223 bp
  • A to G, chromosome 9 at 80,242,249 bp
  • A to T, chromosome 9 at 121,367,055 bp
  • T to C, chromosome 10 at 43,958,336 bp
  • C to T, chromosome 10 at 57,801,067 bp
  • A to G, chromosome 10 at 59,827,232 bp
  • A to T, chromosome 10 at 62,578,241 bp
  • G to A, chromosome 10 at 75,925,456 bp
  • C to A, chromosome 10 at 89,413,975 bp
  • T to C, chromosome 10 at 93,970,510 bp
  • G to A, chromosome 11 at 44,991,468 bp
  • T to C, chromosome 11 at 70,395,099 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • T to C, chromosome 11 at 73,906,626 bp
  • A to G, chromosome 11 at 76,166,248 bp
  • G to C, chromosome 11 at 105,974,826 bp
  • T to C, chromosome 12 at 8,011,384 bp
  • T to G, chromosome 12 at 85,923,045 bp
  • T to C, chromosome 12 at 101,549,811 bp
  • C to G, chromosome 12 at 108,681,522 bp
  • C to A, chromosome 13 at 46,684,153 bp
  • T to C, chromosome 13 at 49,590,076 bp
  • T to A, chromosome 13 at 102,853,780 bp
  • T to C, chromosome 14 at 47,394,223 bp
  • T to G, chromosome 14 at 79,064,902 bp
  • G to T, chromosome 15 at 4,035,350 bp
  • T to A, chromosome 16 at 20,560,278 bp
  • A to T, chromosome 16 at 45,808,258 bp
  • T to C, chromosome 17 at 5,928,253 bp
  • T to G, chromosome 17 at 27,876,990 bp
  • G to T, chromosome 17 at 35,017,846 bp
  • G to A, chromosome 17 at 48,249,728 bp
  • A to T, chromosome 17 at 79,667,989 bp
  • T to A, chromosome 17 at 87,980,288 bp
  • C to A, chromosome 18 at 13,845,448 bp
  • A to T, chromosome 18 at 24,004,137 bp
  • T to C, chromosome 18 at 31,153,764 bp
  • T to G, chromosome 18 at 37,717,380 bp
  • C to T, chromosome X at 74,277,038 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5137 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042723-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.