Strain Name:
C57BL/6J-MtgxR5137Btlr/Mmmh
Stock Number:
042723-MU
Citation ID:
RRID:MMRRC_042723-MU
Other Names:
R5137 (G1), C57BL/6J-MtgxR5137Btlr
Major Collection:

Strain Information

Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: NO, bNOS, 2310005C01Rik, nNOS, Nos-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Omd
Name: osteomodulin
Synonyms: osteoadherin, SLRR2C, OSAD
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27047
VEGA: 13
HGNC: HGNC:8134
Homologene: 3677
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Zfp384
Name: zinc finger protein 384
Synonyms: C130073D16Rik, Nmp4, Ciz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269800
Homologene: 15849
B3galnt1
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
Synonyms: Brainiac 1, Mbrn 1, Globoside blood group, B3galt3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26879
HGNC: HGNC:918
Homologene: 32457
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Pdk1
Name: pyruvate dehydrogenase kinase, isoenzyme 1
Synonyms: D530020C15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228026
HGNC: HGNC:8809
Homologene: 134437
Micu1
Name: mitochondrial calcium uptake 1
Synonyms: C730016L05Rik, Cbara1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216001
HGNC: HGNC:1530
Homologene: 4431
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Ezh2
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms: KMT6, Enx-1, Enx1h
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14056
HGNC: HGNC:3527
Homologene: 37926
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Vps53
Name: VPS53 GARP complex subunit
Synonyms: 3100002B05Rik, 2310040I21Rik, 2010002A08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68299
Homologene: 6264
Dlgap5
Name: DLG associated protein 5
Synonyms: Dlg7, Hurp, C86398
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218977
Homologene: 8840
Kifbp
Name: kinesin family binding protein
Synonyms: 2510003E04Rik, Kif1bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72320
Homologene: 9223
Nol9
Name: nucleolar protein 9
Synonyms: 4632412I24Rik, 6030462G04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74035
Homologene: 32589
Bltp3a
Name: bridge-like lipid transfer protein family member 3A
Synonyms: F830021D11Rik, Uhrf1bp1, 1110020K19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224648
Homologene: 9816
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: Ayu17-449, E130014J05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: 2810449H11Rik, D130015N03Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Gas2l3
Name: growth arrest-specific 2 like 3
Synonyms: LOC237436, 8430435B07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237436
VEGA: 10
Homologene: 18386
Zfp35
Name: zinc finger protein 35
Synonyms: Zfp-35
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22694
Homologene: 133081
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: DEP-1, CD148, RPTPJ, Scc-1, Scc1, Byp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Trak1
Name: trafficking protein, kinesin binding 1
Synonyms: 2310001H13Rik, hyrt
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67095
Homologene: 25103
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2610101O16Rik, Gtl4, 2810409N01Rik, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Msh6
Name: mutS homolog 6
Synonyms: Msh6, Gtmbp, GTBP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17688
VEGA: 17
HGNC: HGNC:7329
Homologene: 149
Dnaaf5
Name: dynein, axonemal assembly factor 5
Synonyms: Heatr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433956
Homologene: 41198
Tardbp
Name: TAR DNA binding protein
Synonyms: 1190002A23Rik, Tdp43, TDP-43
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230908
Homologene: 7221
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: Zfp650, 1110059H15Rik, 4833421P10Rik, A130030D10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68795
Homologene: 52092
Abcf3
Name: ATP-binding cassette, sub-family F member 3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27406
HGNC: HGNC:72
Homologene: 22784
Snx9
Name: sorting nexin 9
Synonyms: SH3PX1, SDP1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66616
VEGA: 17
Homologene: 49454
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Ebf1
Name: early B cell factor 1
Synonyms: Olf1, Olf-1, O/E-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13591
HGNC: HGNC:3126
Homologene: 7297
Ttll5
Name: tubulin tyrosine ligase-like family, member 5
Synonyms: 2310009M18Rik, 4930556H18Rik, D630041K24Rik, STAMP, 1700048H13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320244
Homologene: 9013
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, skrr, Ryr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Cox5b
Name: cytochrome c oxidase subunit 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12859
HGNC: HGNC:2269
Homologene: 133751
Gprc5d
Name: G protein-coupled receptor, family C, group 5, member D
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93746
Homologene: 10250
Slc35d1
Name: solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
Synonyms: UGTREL7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242585
Homologene: 22870
Myo6
Name: myosin VI
Synonyms: Tlc, Myo6rsv, rsv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17920
HGNC: HGNC:7605
Homologene: 56417
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: Sn, CD169, Siglec-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20612
Homologene: 124458
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: T1/ST2, T1 gene, DER4, Fit-1, St2, T1, St2-rs1, ST2L, Ly84, ST2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Vwa7
Name: von Willebrand factor A domain containing 7
Synonyms: G7c, D17H6S56E-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27762
Homologene: 11895
Kcng4
Name: potassium voltage-gated channel, subfamily G, member 4
Synonyms: KV6.4, 4921535I01Rik, KV6.3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66733
Homologene: 23553
Or1e35
Name: olfactory receptor family 1 subfamily E member 35
Synonyms: Olfr395, GA_x6K02T2P1NL-4062605-4061667, MOR135-10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259007
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, C030033M19Rik, RIM1alpha, RIM1a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Eya2
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14049
HGNC: HGNC:3520
Homologene: 40711
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 1300010F03Rik, 4932416F07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Rmdn2
Name: regulator of microtubule dynamics 2
Synonyms: Fam82a1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381110
VEGA: 17
Homologene: 71930
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Acad9
Name: acyl-Coenzyme A dehydrogenase family, member 9
Synonyms: 2600017P15Rik, NPD002, C630012L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229211
Homologene: 8539
Or4c120
Name: olfactory receptor family 4 subfamily C member 120
Synonyms: Olfr1225, MOR233-11, GA_x6K02T2Q125-50650037-50649102
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258893
Homologene: 17427
Zfp521
Name: zinc finger protein 521
Synonyms: B930086A16Rik, Evi3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225207
VEGA: 18
Homologene: 9151
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: 2810483F24Rik, Jnkbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Ube2l6
Name: ubiquitin-conjugating enzyme E2L 6
Synonyms: RIG-B, 2810489I21Rik, Ubcm8, Ubce8, UBCH8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56791
Homologene: 3112
Kcna5
Name: potassium voltage-gated channel, shaker-related subfamily, member 5
Synonyms: Kv1.5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16493
HGNC: HGNC:6224
Homologene: 1683
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269233
Homologene: 19521
Large1
Name: LARGE xylosyl- and glucuronyltransferase 1
Synonyms: froggy, fg, enr, BPFD#36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16795
HGNC: HGNC:6511
Homologene: 7810
Mmp11
Name: matrix metallopeptidase 11
Synonyms: ST3, stromelysin 3, Stmy3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17385
HGNC: HGNC:7157
Homologene: 38116
Adh4
Name: alcohol dehydrogenase 4 (class II), pi polypeptide
Synonyms: mouse class II type ADH, Adh2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26876
HGNC: HGNC:252
Homologene: 20162
Slc16a14
Name: solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms: 1110004H10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71781
Homologene: 34318
Or51l14
Name: olfactory receptor family 51 subfamily L member 14
Synonyms: MOR17-2, GA_x6K02T2PBJ9-6173009-6173968, Olfr606
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259098
Homologene: 110570
Spaca1
Name: sperm acrosome associated 1
Synonyms: 1700124L11Rik, 4930540L03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67652
Homologene: 12170
Ace
Name: angiotensin I converting enzyme
Synonyms: CD143
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11421
HGNC: HGNC:2707
Homologene: 37351
Rit2
Name: Ras-like without CAAX 2
Synonyms: Rin, Roc2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19762
Homologene: 2198
Eef2k
Name: eukaryotic elongation factor-2 kinase
Synonyms: eEF-2K
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13631
Homologene: 7299
Smpdl3a
Name: sphingomyelin phosphodiesterase, acid-like 3A
Synonyms: ASM3A, ASML3A, 0610010C24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57319
Homologene: 4886
Negr1
Name: neuronal growth regulator 1
Synonyms: 5330422G01Rik, neurotractin, Ntra
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320840
Homologene: 41447
Vezt
Name: vezatin, adherens junctions transmembrane protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215008
Homologene: 9739
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Or1e16
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: MOR135-13, I54, GA_x6K02T2P1NL-3556334-3555390, Olfr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258923
Homologene: 115482
Oxct1
Name: 3-oxoacid CoA transferase 1
Synonyms: 2610008O03Rik, Scot-s
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67041
HGNC: HGNC:8527
Homologene: 377
Pcmtd2
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms: 5330414D10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245867
Homologene: 10099
Trem3
Name: triggering receptor expressed on myeloid cells 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58218
VEGA: 17
Homologene: 87012
Dnase1l1
Name: deoxyribonuclease 1-like 1
Synonyms: Dnase1ll, G4.8, Dnl1ll, 2310005K03Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 69537
HGNC: HGNC:2957
Homologene: 4896
Pcdhga7
Name: protocadherin gamma subfamily A, 7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93715
HGNC: HGNC:8705
Homologene: 36377
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 22,288,620 bp
  • A to G, chromosome 1 at 36,692,429 bp
  • A to T, chromosome 1 at 40,450,125 bp
  • T to A, chromosome 1 at 84,912,597 bp
  • T to A, chromosome 1 at 118,855,503 bp
  • T to C, chromosome 2 at 3,225,389 bp
  • T to C, chromosome 2 at 69,973,335 bp
  • T to G, chromosome 2 at 71,883,569 bp
  • T to G, chromosome 2 at 84,802,876 bp
  • C to A, chromosome 2 at 89,170,400 bp
  • T to C, chromosome 2 at 90,469,648 bp
  • T to G, chromosome 2 at 117,163,571 bp
  • T to A, chromosome 2 at 120,022,181 bp
  • C to T, chromosome 2 at 131,081,344 bp
  • T to C, chromosome 2 at 165,731,628 bp
  • A to T, chromosome 2 at 181,854,994 bp
  • T to C, chromosome 3 at 36,069,771 bp
  • G to T, chromosome 3 at 69,574,949 bp
  • T to C, chromosome 3 at 133,476,565 bp
  • T to C, chromosome 3 at 138,422,235 bp
  • T to A, chromosome 3 at 157,016,196 bp
  • A to G, chromosome 4 at 11,546,297 bp
  • A to T, chromosome 4 at 34,029,095 bp
  • A to T, chromosome 4 at 103,214,781 bp
  • T to A, chromosome 4 at 143,949,120 bp
  • T to C, chromosome 4 at 148,622,037 bp
  • T to A, chromosome 4 at 152,045,971 bp
  • C to T, chromosome 5 at 21,955,181 bp
  • T to C, chromosome 5 at 117,905,313 bp
  • C to T, chromosome 5 at 139,181,460 bp
  • A to T, chromosome 6 at 47,532,080 bp
  • A to G, chromosome 6 at 120,755,517 bp
  • ACAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGC, chromosome 6 at 125,036,509 bp
  • A to T, chromosome 6 at 126,533,983 bp
  • T to A, chromosome 6 at 135,116,033 bp
  • T to C, chromosome 7 at 29,101,858 bp
  • T to C, chromosome 7 at 41,042,894 bp
  • A to G, chromosome 7 at 103,451,712 bp
  • C to A, chromosome 7 at 103,451,713 bp
  • G to A, chromosome 7 at 120,885,422 bp
  • C to A, chromosome 7 at 120,885,423 bp
  • A to G, chromosome 8 at 73,048,309 bp
  • A to T, chromosome 8 at 119,625,878 bp
  • G to T, chromosome 8 at 124,694,935 bp
  • A to G, chromosome 9 at 66,448,223 bp
  • A to G, chromosome 9 at 80,242,249 bp
  • A to T, chromosome 9 at 121,367,055 bp
  • T to C, chromosome 10 at 43,958,336 bp
  • C to T, chromosome 10 at 57,801,067 bp
  • A to G, chromosome 10 at 59,827,232 bp
  • A to T, chromosome 10 at 62,578,241 bp
  • G to A, chromosome 10 at 75,925,456 bp
  • C to A, chromosome 10 at 89,413,975 bp
  • T to C, chromosome 10 at 93,970,510 bp
  • G to A, chromosome 11 at 44,991,468 bp
  • T to C, chromosome 11 at 70,395,099 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • T to C, chromosome 11 at 73,906,626 bp
  • A to G, chromosome 11 at 76,166,248 bp
  • G to C, chromosome 11 at 105,974,826 bp
  • T to C, chromosome 12 at 8,011,384 bp
  • T to G, chromosome 12 at 85,923,045 bp
  • T to C, chromosome 12 at 101,549,811 bp
  • C to G, chromosome 12 at 108,681,522 bp
  • C to A, chromosome 13 at 46,684,153 bp
  • T to C, chromosome 13 at 49,590,076 bp
  • T to A, chromosome 13 at 102,853,780 bp
  • T to C, chromosome 14 at 47,394,223 bp
  • T to G, chromosome 14 at 79,064,902 bp
  • G to T, chromosome 15 at 4,035,350 bp
  • T to A, chromosome 16 at 20,560,278 bp
  • A to T, chromosome 16 at 45,808,258 bp
  • T to C, chromosome 17 at 5,928,253 bp
  • T to G, chromosome 17 at 27,876,990 bp
  • G to T, chromosome 17 at 35,017,846 bp
  • G to A, chromosome 17 at 48,249,728 bp
  • A to T, chromosome 17 at 79,667,989 bp
  • T to A, chromosome 17 at 87,980,288 bp
  • C to A, chromosome 18 at 13,845,448 bp
  • A to T, chromosome 18 at 24,004,137 bp
  • T to C, chromosome 18 at 31,153,764 bp
  • T to G, chromosome 18 at 37,717,380 bp
  • C to T, chromosome X at 74,277,038 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5137 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042723-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.