Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5216Btlr/Mmmh
Stock Number:
042789-MU
Citation ID:
RRID:MMRRC_042789-MU
Other Names:
R5216 (G1), C57BL/6J-MtgxR5216Btlr
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Zfp113
Name: zinc finger protein 113
Synonyms: 4732456B05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56314
Homologene: 50027
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Mgll
Name: monoglyceride lipase
Synonyms: Magl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23945
Homologene: 38298
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
2700097O09Rik
Name: RIKEN cDNA 2700097O09 gene
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72658
Homologene: 36458
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Pik3c3
Name: phosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms: Vps34, 5330434F23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225326
HGNC: HGNC:8974
Homologene: 1986
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64898
Homologene: 8769
Ahi1
Name: Abelson helper integration site 1
Synonyms: Ahi-1, 1700015F03Rik, D10Bwg0629e, Jouberin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsp, Tsbp, Sh2bp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Mmp14
Name: matrix metallopeptidase 14 (membrane-inserted)
Synonyms: Membrane type 1-MMP, MT1-MMP, sabe
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17387
HGNC: HGNC:7160
Homologene: 21040
Wnt2b
Name: wingless-type MMTV integration site family, member 2B
Synonyms: Wnt13
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22414
Homologene: 22526
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Atp13a3
Name: ATPase type 13A3
Synonyms: LOC224088, LOC224087, LOC385637
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224088
Homologene: 23455
Cabp7
Name: calcium binding protein 7
Synonyms: calneuron II
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192650
Homologene: 16364
Pfkl
Name: phosphofructokinase, liver, B-type
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18641
HGNC: HGNC:8876
Homologene: 55668
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Arhgef3
Name: Rho guanine nucleotide exchange factor 3
Synonyms: 1200004I24Rik, C76747, 9830169H03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71704
VEGA: 14
HGNC: HGNC:683
Homologene: 41329
Klhl20
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226541
Homologene: 8699
Tnip2
Name: TNFAIP3 interacting protein 2
Synonyms: ABIN-2, 1810020H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231130
Homologene: 11515
Trmt2a
Name: TRM2 tRNA methyltransferase 2A
Synonyms: Htf9c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15547
Homologene: 7374
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Cngb3
Name: cyclic nucleotide gated channel beta 3
Synonyms: CNG6, CCNC2, Cngbeta2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30952
HGNC: HGNC:2153
Homologene: 40908
Cacng5
Name: calcium channel, voltage-dependent, gamma subunit 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140723
HGNC: HGNC:1409
Homologene: 15424
Cyp2d41-ps
Name: cytochrome P450, family 2, subfamily d, member 41, pseudogene
Synonyms: Gm5062
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 271300
Vmn1r67
Name: vomeronasal 1 receptor 67
Synonyms: V1re10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171263
Homologene: 128344
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Grb14
Name: growth factor receptor bound protein 14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50915
HGNC: HGNC:4565
Homologene: 3303
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Or7e166
Name: olfactory receptor family 7 subfamily E member 166
Synonyms: GA_x6K02T2PVTD-13452606-13453535, MOR146-8P, Olfr857
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257963
Homologene: 134093
Or1e33
Name: olfactory receptor family 1 subfamily E member 33
Synonyms: GA_x6K02T2P1NL-4004140-4003208, MOR135-7, Olfr393
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259010
Homologene: 79335
Aldh1b1
Name: aldehyde dehydrogenase 1 family, member B1
Synonyms: 2700007F14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72535
HGNC: HGNC:407
Homologene: 115470
Vmn2r-ps69
Name: vomeronasal 2, receptor, pseudogene 69
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 670926
Actg1
Name: actin, gamma, cytoplasmic 1
Synonyms: E51, Actl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11465
HGNC: HGNC:144
Homologene: 74402
Or52k2
Name: olfactory receptor family 52 subfamily K member 2
Synonyms: GA_x6K02T2PBJ9-5323062-5324015, MOR28-1, Olfr552
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259106
Homologene: 73941
Syt1
Name: synaptotagmin I
Synonyms: G630098F17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20979
Homologene: 4122
Hoxd1
Name: homeobox D1
Synonyms: Hox-4.9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15429
HGNC: HGNC:5132
Homologene: 7772
Got2-ps1
Name: glutamatic-oxaloacetic transaminase 2, mitochondrial, pseudogene 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14720
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 12,796,874 bp
  • C to A, chromosome 1 at 153,227,696 bp
  • A to G, chromosome 1 at 161,093,679 bp
  • C to T, chromosome 2 at 64,917,309 bp
  • A to T, chromosome 2 at 74,764,351 bp
  • T to C, chromosome 2 at 168,674,888 bp
  • A to G, chromosome 3 at 104,961,345 bp
  • A to G, chromosome 3 at 107,439,441 bp
  • G to A, chromosome 3 at 145,315,310 bp
  • T to A, chromosome 4 at 19,415,729 bp
  • G to T, chromosome 4 at 45,803,652 bp
  • T to C, chromosome 5 at 8,813,705 bp
  • C to T, chromosome 5 at 34,503,805 bp
  • C to T, chromosome 5 at 138,150,715 bp
  • A to G, chromosome 5 at 138,364,454 bp
  • T to A, chromosome 5 at 150,542,980 bp
  • T to C, chromosome 6 at 42,356,532 bp
  • T to A, chromosome 6 at 88,766,329 bp
  • A to G, chromosome 6 at 114,724,949 bp
  • A to G, chromosome 7 at 10,447,163 bp
  • AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC to AATTCAGGCCTAGGCTGGGATTCAGGC, chromosome 7 at 27,327,311 bp
  • A to T, chromosome 7 at 85,309,594 bp
  • A to G, chromosome 7 at 102,604,821 bp
  • T to A, chromosome 7 at 111,045,458 bp
  • T to C, chromosome 9 at 16,377,537 bp
  • T to A, chromosome 9 at 19,713,289 bp
  • T to C, chromosome 10 at 20,960,076 bp
  • T to G, chromosome 10 at 78,009,670 bp
  • T to C, chromosome 10 at 108,642,257 bp
  • A to G, chromosome 11 at 4,738,873 bp
  • A to T, chromosome 11 at 73,847,436 bp
  • A to G, chromosome 11 at 107,877,489 bp
  • G to A, chromosome 11 at 119,843,713 bp
  • A to T, chromosome 11 at 120,347,754 bp
  • A to T, chromosome 12 at 55,061,162 bp
  • G to A, chromosome 13 at 113,342,413 bp
  • A to G, chromosome 14 at 27,401,842 bp
  • A to G, chromosome 14 at 54,437,663 bp
  • T to A, chromosome 15 at 44,495,647 bp
  • G to T, chromosome 15 at 82,779,190 bp
  • A to G, chromosome 16 at 4,661,918 bp
  • A to G, chromosome 16 at 18,252,184 bp
  • A to G, chromosome 16 at 30,340,284 bp
  • C to T, chromosome 17 at 71,242,760 bp
  • T to A, chromosome 17 at 74,613,470 bp
  • A to G, chromosome 18 at 30,272,976 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5216 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042789-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.