Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5464Btlr/Mmmh
Stock Number:
042850-MU
Citation ID:
RRID:MMRRC_042850-MU
Other Names:
R5464 (G1), C57BL/6J-MtgxR5464Btlr
Major Collection:

Strain Information

Trim32
Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69807
Homologene: 36327
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Ift52
Name: intraflagellar transport 52
Synonyms: NGD5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245866
Homologene: 9335
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Gpatch4
Name: G patch domain containing 4
Synonyms: 2610029K21Rik, Gpatc4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66614
Homologene: 9203
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217995
VEGA: 13
Homologene: 34562
Sf3a3
Name: splicing factor 3a, subunit 3
Synonyms: 4930512K19Rik, 60kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75062
Homologene: 4949
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 85,694,223 bp
  • A to T, chromosome 1 at 107,271,704 bp
  • C to T, chromosome 2 at 65,701,756 bp
  • AAGTCTGGAGTC to AAGTC, chromosome 2 at 85,414,713 bp
  • T to C, chromosome 2 at 88,540,255 bp
  • C to T, chromosome 2 at 109,191,622 bp
  • T to A, chromosome 2 at 157,221,230 bp
  • T to C, chromosome 2 at 163,029,815 bp
  • T to C, chromosome 2 at 181,380,213 bp
  • T to C, chromosome 3 at 88,054,755 bp
  • C to A, chromosome 3 at 93,201,970 bp
  • A to G, chromosome 3 at 94,944,416 bp
  • T to C, chromosome 3 at 129,915,716 bp
  • T to A, chromosome 4 at 40,724,133 bp
  • A to G, chromosome 4 at 65,614,388 bp
  • TGGGGGAGGAGGAAGAGGACTCTGGGGAGGAGGAGGAGGAGGAGG to TGG, chromosome 4 at 98,736,750 bp
  • T to C, chromosome 4 at 124,728,240 bp
  • C to T, chromosome 4 at 131,772,557 bp
  • T to A, chromosome 4 at 141,006,070 bp
  • T to A, chromosome 4 at 154,346,144 bp
  • T to G, chromosome 5 at 8,983,690 bp
  • T to C, chromosome 5 at 73,608,279 bp
  • T to C, chromosome 6 at 54,485,323 bp
  • A to G, chromosome 6 at 81,962,011 bp
  • C to T, chromosome 6 at 137,527,475 bp
  • T to C, chromosome 7 at 44,732,638 bp
  • T to C, chromosome 7 at 65,635,640 bp
  • T to C, chromosome 7 at 102,713,682 bp
  • A to G, chromosome 7 at 102,723,917 bp
  • A to G, chromosome 7 at 102,775,433 bp
  • T to A, chromosome 7 at 103,732,189 bp
  • C to A, chromosome 7 at 104,068,467 bp
  • A to T, chromosome 7 at 127,934,233 bp
  • G to T, chromosome 7 at 144,436,939 bp
  • T to A, chromosome 8 at 46,505,738 bp
  • A to G, chromosome 9 at 30,427,973 bp
  • A to T, chromosome 9 at 39,669,770 bp
  • T to C, chromosome 9 at 40,187,784 bp
  • T to C, chromosome 10 at 33,909,341 bp
  • C to T, chromosome 11 at 30,506,354 bp
  • T to C, chromosome 11 at 70,317,679 bp
  • C to T, chromosome 11 at 100,876,735 bp
  • A to T, chromosome 12 at 76,428,078 bp
  • G to A, chromosome 12 at 104,268,492 bp
  • T to A, chromosome 13 at 12,433,643 bp
  • A to T, chromosome 13 at 34,178,064 bp
  • T to A, chromosome 13 at 70,761,749 bp
  • A to G, chromosome 14 at 61,236,855 bp
  • T to A, chromosome 15 at 90,993,855 bp
  • G to A, chromosome 16 at 4,864,363 bp
  • T to A, chromosome 16 at 32,273,876 bp
  • A to G, chromosome 18 at 63,145,105 bp
  • C to T, chromosome 18 at 80,211,923 bp
  • T to C, chromosome 19 at 8,713,644 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5464 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042850-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.