Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5311Btlr/Mmmh
Stock Number:
042894-MU
Citation ID:
RRID:MMRRC_042894-MU
Other Names:
R5311 (G1), C57BL/6J-MtgxR5311Btlr
Major Collection:

Strain Information

Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Fam53a
Name: family with sequence similarity 53, member A
Synonyms: 5430419M09Rik, DNTNP, 2410018C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74504
Homologene: 18660
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Nckap1
Name: NCK-associated protein 1
Synonyms: mh19, Hem-2, H19, Nap1, Hem2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50884
HGNC: HGNC:7666
Homologene: 8384
Trps1
Name: transcriptional repressor GATA binding 1
Synonyms: D15Ertd586e, trichorhinophalangeal syndrome I (human)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83925
Homologene: 8556
Gfm2
Name: G elongation factor, mitochondrial 2
Synonyms: MST027, EFG2, A930009M04Rik, 6530419G12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320806
Homologene: 6238
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,565,870 bp
  • T to A, chromosome 1 at 38,079,393 bp
  • A to G, chromosome 1 at 63,720,004 bp
  • T to C, chromosome 2 at 6,950,894 bp
  • T to C, chromosome 2 at 10,110,535 bp
  • T to C, chromosome 2 at 37,219,621 bp
  • T to A, chromosome 2 at 80,540,122 bp
  • T to A, chromosome 2 at 86,374,750 bp
  • T to A, chromosome 2 at 91,128,678 bp
  • T to C, chromosome 2 at 93,696,261 bp
  • C to A, chromosome 2 at 121,302,387 bp
  • T to C, chromosome 2 at 131,079,316 bp
  • A to T, chromosome 2 at 176,810,672 bp
  • AAACCCTA to AA, chromosome 2 at 177,509,655 bp
  • G to A, chromosome 4 at 43,673,992 bp
  • T to C, chromosome 4 at 45,917,556 bp
  • G to A, chromosome 4 at 111,980,304 bp
  • A to T, chromosome 5 at 24,377,345 bp
  • A to G, chromosome 5 at 33,607,736 bp
  • A to T, chromosome 5 at 52,554,485 bp
  • G to A, chromosome 5 at 87,011,280 bp
  • T to C, chromosome 5 at 109,006,255 bp
  • A to G, chromosome 5 at 110,289,278 bp
  • A to G, chromosome 5 at 142,467,687 bp
  • A to G, chromosome 7 at 6,305,716 bp
  • C to T, chromosome 7 at 48,643,311 bp
  • C to A, chromosome 7 at 140,811,959 bp
  • A to C, chromosome 9 at 53,518,623 bp
  • G to C, chromosome 9 at 122,166,320 bp
  • A to G, chromosome 9 at 123,084,166 bp
  • A to G, chromosome 10 at 24,595,801 bp
  • G to A, chromosome 10 at 58,607,435 bp
  • A to G, chromosome 10 at 103,214,587 bp
  • GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC to GGAGGCCGCCCAGTGGCAGAGGC, chromosome 11 at 26,593,725 bp
  • T to A, chromosome 11 at 48,888,889 bp
  • T to C, chromosome 11 at 83,004,084 bp
  • T to C, chromosome 11 at 100,372,494 bp
  • A to T, chromosome 12 at 103,985,962 bp
  • T to A, chromosome 13 at 23,162,893 bp
  • G to A, chromosome 13 at 97,163,151 bp
  • C to A, chromosome 13 at 109,632,864 bp
  • C to T, chromosome 13 at 109,632,865 bp
  • G to A, chromosome 15 at 50,664,760 bp
  • A to G, chromosome 16 at 17,210,844 bp
  • C to T, chromosome 16 at 18,795,897 bp
  • A to G, chromosome 16 at 34,921,757 bp
  • A to G, chromosome 16 at 49,165,841 bp
  • G to A, chromosome 17 at 20,029,901 bp
  • A to G, chromosome 17 at 31,219,717 bp
  • G to A, chromosome 17 at 37,362,881 bp
  • A to T, chromosome 17 at 89,011,013 bp
  • T to A, chromosome 18 at 4,386,328 bp
  • C to T, chromosome 18 at 37,959,873 bp
  • A to T, chromosome 18 at 43,171,505 bp
  • C to A, chromosome 19 at 6,531,398 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5311 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042894-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.