Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5314Btlr/Mmmh
Stock Number:
042897-MU
Citation ID:
RRID:MMRRC_042897-MU
Other Names:
R5314 (G1), C57BL/6J-MtgxR5314Btlr
Major Collection:

Strain Information

Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Epc1
Name: enhancer of polycomb homolog 1
Synonyms: 5730566F07Rik, 2400007E14Rik, A930032N02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13831
Homologene: 32627
Snrnp70
Name: small nuclear ribonucleoprotein 70 (U1)
Synonyms: Rnulp70, U1-70, 2700022N21Rik, 3200002N22Rik, Srnp70, Snrp70
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20637
Homologene: 20672
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 56,831,527 bp
  • C to T, chromosome 1 at 84,580,739 bp
  • A to G, chromosome 2 at 24,400,516 bp
  • A to T, chromosome 2 at 52,281,503 bp
  • A to G, chromosome 2 at 120,377,926 bp
  • T to C, chromosome 3 at 28,765,311 bp
  • A to T, chromosome 3 at 35,834,390 bp
  • C to T, chromosome 3 at 90,261,041 bp
  • A to G, chromosome 3 at 95,764,089 bp
  • G to A, chromosome 3 at 103,999,287 bp
  • T to C, chromosome 3 at 121,679,523 bp
  • T to C, chromosome 4 at 55,013,178 bp
  • T to C, chromosome 4 at 129,224,212 bp
  • T to A, chromosome 4 at 139,655,361 bp
  • A to T, chromosome 5 at 52,647,673 bp
  • C to T, chromosome 5 at 67,705,905 bp
  • T to C, chromosome 5 at 100,063,823 bp
  • A to G, chromosome 5 at 123,322,563 bp
  • G to T, chromosome 6 at 29,417,498 bp
  • A to T, chromosome 6 at 126,967,046 bp
  • G to A, chromosome 7 at 12,416,160 bp
  • T to A, chromosome 7 at 16,184,064 bp
  • T to A, chromosome 7 at 17,158,371 bp
  • G to A, chromosome 7 at 45,377,052 bp
  • AAGCAGCAGCAGCAGCAGCAGCAGCA to AAGCAGCAGCAGCAGCAGCAGCA, chromosome 7 at 49,408,692 bp
  • T to C, chromosome 7 at 56,219,786 bp
  • A to T, chromosome 7 at 114,494,537 bp
  • A to G, chromosome 8 at 25,862,458 bp
  • T to C, chromosome 8 at 40,915,030 bp
  • A to G, chromosome 8 at 69,226,721 bp
  • G to A, chromosome 8 at 121,608,598 bp
  • T to C, chromosome 9 at 39,394,489 bp
  • T to A, chromosome 9 at 109,693,178 bp
  • A to T, chromosome 10 at 24,101,348 bp
  • A to T, chromosome 10 at 49,240,792 bp
  • T to C, chromosome 10 at 58,607,360 bp
  • A to T, chromosome 11 at 4,150,078 bp
  • T to C, chromosome 11 at 46,677,260 bp
  • A to T, chromosome 11 at 100,204,700 bp
  • C to T, chromosome 12 at 4,627,960 bp
  • A to G, chromosome 13 at 95,086,853 bp
  • A to G, chromosome 15 at 7,304,012 bp
  • A to C, chromosome 15 at 9,108,313 bp
  • C to G, chromosome 15 at 55,642,795 bp
  • C to A, chromosome 15 at 74,080,349 bp
  • T to A, chromosome 15 at 85,070,865 bp
  • A to G, chromosome 15 at 92,295,011 bp
  • G to A, chromosome 15 at 98,340,365 bp
  • T to C, chromosome 16 at 75,596,586 bp
  • G to A, chromosome 17 at 25,343,398 bp
  • T to C, chromosome 17 at 45,566,498 bp
  • T to A, chromosome 17 at 48,300,573 bp
  • G to A, chromosome 17 at 56,128,413 bp
  • A to G, chromosome 18 at 6,462,969 bp
  • A to T, chromosome 18 at 36,561,058 bp
  • A to G, chromosome 18 at 60,270,292 bp
  • T to A, chromosome 18 at 61,129,724 bp
  • T to C, chromosome 19 at 13,655,266 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5314 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.