Strain Name:
Stock Number:
Citation ID:
Other Names:
R5341 (G1), C57BL/6J-MtgxR5341Btlr
Major Collection:

Strain Information

Name: gulonolactone (L-) oxidase
Synonyms: L-gulono-gamma-lactone oxidase, sfx
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268756
VEGA: 14
Homologene: 6566
Name: cell adhesion molecule-related/down-regulated by oncogenes
Synonyms: CDO, CAM-related/down-regulated by oncogenes
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57810
Homologene: 22996
Name: zinc finger protein 97
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22759
Homologene: 133884
Name: fizzy and cell division cycle 20 related 1
Synonyms: Fyr, Cdh1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56371
Homologene: 9444
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Name: zinc finger, DBF-type containing 2
Synonyms: 4930431J08Rik, 9330107J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Name: ankyrin repeat and BTB domain containing 3
Synonyms: 6330404E16Rik, Btbd11
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74007
Homologene: 72536
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Synonyms: Pipk5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18719
Homologene: 100644
Name: timeless circadian clock 1
Synonyms: tim
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21853
Homologene: 31206
Name: recombination signal binding protein for immunoglobulin kappa J region
Synonyms: CBF1, Igkrsbp, RBP-J kappa, RBPjk, Igkjrb, Rbpsuh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19664
Homologene: 7511
Name: ecto-NOX disulfide-thiol exchanger 1
Synonyms: D230005D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239188
VEGA: 14
Homologene: 56793
Name: strawberry notch 1
Synonyms: sno, 9330180L10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243272
Homologene: 10055
Name: sorting nexin 8
Synonyms: B130023O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231834
Homologene: 8338
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 208836
Homologene: 49530
Name: bora, aurora kinase A activator
Synonyms: 6720463M24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 77744
VEGA: 14
Homologene: 11728
Name: methylphosphate capping enzyme
Synonyms: D5Wsu46e, Bcdin3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231803
Homologene: 32447
Name: DEAH-box helicase 8
Synonyms: mDEAH6, RNA helicase, Ddx8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217207
Homologene: 3628
Name: matrix metallopeptidase 17
Synonyms: MT4-MMP, membrane type-4 matrix metalloproteinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23948
Homologene: 22669
Name: pygopus 2
Synonyms: 1190004M21Rik, mpygo2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68911
Homologene: 44519
Name: synaptotagmin XIII
Synonyms: 5730409J20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80976
Homologene: 10823
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
Homologene: 41419
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Name: CD300A molecule
Synonyms: Pigr4, MMAC8, Clm8, LMIR1, B230315M08Rik, MAIR-I
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217303
Homologene: 48514
Name: carboxypeptidase X, M14 family member 2
Synonyms: 4632435C11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55987
Homologene: 69259
Name: serine/threonine kinase 11
Synonyms: Lkb1, Par-4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20869
Homologene: 393
Name: LMBR1 domain containing 1
Synonyms: 0910001K20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68421
Homologene: 10156
Name: dynein 2 intermediate chain 1
Synonyms: D430033N04Rik, Wdr60, Dync2l1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217935
VEGA: 12
Homologene: 23067
Name: tetraspanin 12
Synonyms: Tm4sf12
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269831
Homologene: 8212
Name: polycystic kidney disease 2-like 2
Synonyms: Polycystin - L2, TRPP5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53871
VEGA: 18
Homologene: 22812
Name: trans-acting transcription factor 9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381373
Homologene: 66935
Name: centrosomal AT-AC splicing factor
Synonyms: D630044F24Rik, Ccdc84
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382073
Homologene: 13886
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
Homologene: 4900
Name: solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Synonyms: MEAAC1, EAAC1, EAAT3, D130048G10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20510
Homologene: 20881
Name: olfactory receptor family 4 subfamily F member 53
Synonyms: GA_x6K02T2Q125-72308574-72309512, MOR245-10, Olfr1276
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258390
Homologene: 133614
Name: globoside alpha-1,3-N-acetylgalactosaminyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227671
Homologene: 110677
Name: ubiquitin specific peptidase 35
Synonyms: LOC381901, LOC244144
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244144
Homologene: 35459
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Name: zinc finger SWIM-type containing 8
Synonyms: 4832404P21Rik, 2310021P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268721
VEGA: 14
Homologene: 34313
Name: cystatin domain containing 7
Synonyms: Gm5689
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 435561
VEGA: 18
Name: adenylate cyclase activating polypeptide 1 receptor 1
Synonyms: PACAP1-R, PAC1, PAC1R, 2900024I10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11517
Homologene: 870
Name: membrane-spanning 4-domains, subfamily A, member 20
Synonyms: 1700017D01Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69369
Name: IQ motif containing E
Synonyms: 1700028P05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74239
Homologene: 49912
Name: zinc finger protein 422, pseudogene
Synonyms: Krox-25-2, Zfp422-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100416808
Name: transglutaminase 1, K polypeptide
Synonyms: protein-glutamine-gamma-glutamyltransferase, K polypeptide, TG K, TGase 1, 2310004J08Rik, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Name: minichromosome maintenance domain containing 2
Synonyms: 6030422M02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240697
Homologene: 18309
Name: THO complex subunit 2-like
Synonyms: Gm3179, BC005561
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100042165
Name: TXK tyrosine kinase
Synonyms: A130089B16Rik, PTK4, Btkl, Rlk
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22165
Homologene: 2497
Name: microtubule associated tyrosine carboxypeptidase 1
Synonyms: MATCAP, 4931428F04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74356
Homologene: 47588
Name: transmembrane protein 171
Synonyms: LOC380863
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380863
Homologene: 18301
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231396
Homologene: 128251
Name: UDP-N-acetylglucosamine pyrophosphorylase 1
Synonyms: AGX1, AgX, ESTM38, SPAG2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107652
Homologene: 2342
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224576
Homologene: 135824
Name: paired box 5
Synonyms: Pax-5, EBB-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18507
Homologene: 56419
Name: solute carrier family 34 (sodium phosphate), member 3
Synonyms: NPTIIc, Npt2c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 142681
Homologene: 15444
Name: prostate and testis expressed 11
Synonyms: Gm9513
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671003
Homologene: 86450
Name: vomeronasal 1 receptor 6
Synonyms: V1rc20
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171193
Homologene: 128340
Name: ARP5 actin-related protein 5
Synonyms: B430109J19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109275
Homologene: 6818
Name: ADP-ribosyltransferase 5
Synonyms: Yac-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11875
Homologene: 7231
Name: MAS-related GPR, member E
Synonyms: MrgE, C130069N09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244238
Homologene: 18469
Name: RIKEN cDNA 4732440D04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Name: olfactory receptor family 2 subfamily R member 11
Synonyms: GA_x6K02T2P3E9-5100053-5100994, MOR257-4, Olfr458
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258436
Homologene: 133704
Name: thioredoxin domain containing 9
Synonyms: ATP binding protein associated with cell differentiation, Apacd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98258
Homologene: 4225
Name: zinc finger, DHHC domain containing 4
Synonyms: 2900029I10Rik, 1810021D01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72881
Homologene: 10006
Name: integrin linked kinase
Synonyms: ESTM24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16202
Homologene: 3318
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 6,215,042 bp
  • ATAAAAAAAAAGGAAAAATTACCTT to AT, chromosome 1 at 9,940,917 bp
  • A to T, chromosome 1 at 24,746,811 bp
  • A to G, chromosome 1 at 37,987,623 bp
  • T to A, chromosome 1 at 63,307,933 bp
  • C to A, chromosome 1 at 170,143,431 bp
  • A to T, chromosome 2 at 25,230,659 bp
  • C to A, chromosome 2 at 28,505,007 bp
  • T to C, chromosome 2 at 73,274,514 bp
  • A to G, chromosome 2 at 92,953,552 bp
  • T to A, chromosome 2 at 111,257,637 bp
  • C to A, chromosome 2 at 158,625,224 bp
  • C to A, chromosome 3 at 89,432,760 bp
  • T to C, chromosome 4 at 44,697,630 bp
  • A to G, chromosome 5 at 53,642,083 bp
  • T to C, chromosome 5 at 72,696,621 bp
  • A to T, chromosome 5 at 87,092,228 bp
  • A to T, chromosome 5 at 104,518,076 bp
  • A to C, chromosome 5 at 124,408,475 bp
  • A to T, chromosome 5 at 129,602,129 bp
  • A to G, chromosome 5 at 137,783,260 bp
  • A to G, chromosome 5 at 140,358,131 bp
  • A to C, chromosome 5 at 140,690,059 bp
  • A to G, chromosome 5 at 143,326,160 bp
  • A to T, chromosome 6 at 21,835,459 bp
  • A to T, chromosome 6 at 42,460,164 bp
  • A to T, chromosome 6 at 48,459,615 bp
  • C to G, chromosome 6 at 55,478,069 bp
  • T to G, chromosome 6 at 57,002,804 bp
  • T to C, chromosome 7 at 79,406,178 bp
  • T to C, chromosome 7 at 97,325,927 bp
  • C to A, chromosome 7 at 102,098,099 bp
  • T to C, chromosome 7 at 105,740,932 bp
  • T to A, chromosome 7 at 132,154,613 bp
  • T to C, chromosome 7 at 143,781,509 bp
  • A to T, chromosome 8 at 105,285,055 bp
  • A to G, chromosome 9 at 35,470,135 bp
  • A to T, chromosome 9 at 36,477,061 bp
  • A to G, chromosome 9 at 44,417,109 bp
  • C to A, chromosome 10 at 14,132,592 bp
  • A to T, chromosome 10 at 68,278,127 bp
  • A to T, chromosome 10 at 80,126,260 bp
  • A to G, chromosome 10 at 81,368,646 bp
  • A to G, chromosome 10 at 85,387,372 bp
  • T to C, chromosome 10 at 128,247,178 bp
  • A to C, chromosome 11 at 7,130,375 bp
  • A to G, chromosome 11 at 114,893,462 bp
  • T to C, chromosome 12 at 116,255,914 bp
  • G to T, chromosome 13 at 98,688,448 bp
  • G to A, chromosome 14 at 20,716,054 bp
  • A to T, chromosome 14 at 55,700,248 bp
  • T to C, chromosome 14 at 65,988,258 bp
  • A to C, chromosome 14 at 77,577,656 bp
  • T to A, chromosome 14 at 99,068,094 bp
  • A to T, chromosome 15 at 91,772,858 bp
  • T to A, chromosome 17 at 17,145,210 bp
  • T to A, chromosome 17 at 20,277,526 bp
  • C to T, chromosome 17 at 33,305,121 bp
  • A to G, chromosome 18 at 34,409,934 bp
  • A to G, chromosome 18 at 42,173,431 bp
  • T to C, chromosome 19 at 11,110,381 bp
  • T to A, chromosome 19 at 24,304,076 bp
  • T to A, chromosome 19 at 28,897,568 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5341 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042920-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.