Strain Name:
C57BL/6J-MtgxR5343Btlr/Mmmh
Stock Number:
042922-MU
Citation ID:
RRID:MMRRC_042922-MU
Other Names:
R5343 (G1), C57BL/6J-MtgxR5343Btlr
Major Collection:

Strain Information

Spry4
Name: sprouty RTK signaling antagonist 4
Synonyms: sprouty4, A030006O18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 24066
VEGA: 18
Homologene: 8042
Cdh3
Name: cadherin 3
Synonyms: P-cadherin, Cadp, Pcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12560
HGNC: HGNC:1762
Homologene: 20425
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Ezh2
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms: Enx-1, Enx1h, KMT6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14056
HGNC: HGNC:3527
Homologene: 37926
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Srrt
Name: serrate RNA effector molecule homolog (Arabidopsis)
Synonyms: Asr2, Ars2, 2810019G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83701
Homologene: 9298
Set
Name: SET nuclear oncogene
Synonyms: StF-IT-1, 2610030F17Rik, 5730420M11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56086
Homologene: 55707
Chd4
Name: chromodomain helicase DNA binding protein 4
Synonyms: D6Ertd380e, 9530019N15Rik, Mi-2beta
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107932
HGNC: HGNC:1919
Homologene: 68175
Myo1b
Name: myosin IB
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17912
HGNC: HGNC:7596
Homologene: 7856
Mreg
Name: melanoregulin
Synonyms: LOC381269, dsu, Wdt2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381269
Homologene: 9954
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 4632407J06Rik, 2810487N22Rik, B130055D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Lpl
Name: lipoprotein lipase
Synonyms: O 1-4-5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16956
HGNC: HGNC:6677
Homologene: 200
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72333
Homologene: 75052
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67313
Homologene: 10103
Alg8
Name: ALG8 alpha-1,3-glucosyltransferase
Synonyms: LOC381903
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381903
Homologene: 6931
Trim37
Name: tripartite motif-containing 37
Synonyms: MUL, TEF3, 2810004E07Rik, 1110032A10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68729
HGNC: HGNC:7523
Homologene: 9084
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67661
Homologene: 15202
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Mre11a
Name: MRE11A homolog A, double strand break repair nuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17535
HGNC: HGNC:7230
Homologene: 4083
Sema3a
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: SemD, semaphorin III, sema III, collapsin-1, Semad
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20346
Homologene: 31358
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: 2'-5' oligoadenylate synthetase-like 10, Oasl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Crybb3
Name: crystallin, beta B3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12962
HGNC: HGNC:2400
Homologene: 3008
F13b
Name: coagulation factor XIII, beta subunit
Synonyms: Cf-13b, Cf13b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14060
HGNC: HGNC:3534
Homologene: 1512
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: UGT1.6, Ugt1a6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94284
Homologene: 85959
Or9i14
Name: olfactory receptor family 9 subfamily I member 14
Synonyms: GA_x6K02T2RE5P-4147744-4146800, MOR211-2, Olfr1499
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258792
Homologene: 17393
Pilrb2
Name: paired immunoglobin-like type 2 receptor beta 2
Synonyms: EG545812
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545812
Homologene: 114502
Alox5
Name: arachidonate 5-lipoxygenase
Synonyms: 5LO, 5-LOX, 5LX
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11689
HGNC: HGNC:435
Homologene: 561
Pfpl
Name: pore forming protein-like
Synonyms: Epcs5, Epcs50
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56093
VEGA: 19
Homologene: 130704
Agbl4
Name: ATP/GTP binding protein-like 4
Synonyms: 4930578N11Rik, 4931433A01Rik, Ccp6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 78933
Homologene: 84880
Nosip
Name: nitric oxide synthase interacting protein
Synonyms: CGI-25, 2310061K06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66394
Homologene: 9315
P3h2
Name: prolyl 3-hydroxylase 2
Synonyms: Leprel1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 210530
Homologene: 10062
Zcwpw2
Name: zinc finger, CW type with PWWP domain 2
Synonyms: 4930430K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100039681
Homologene: 87409
Mtif2
Name: mitochondrial translational initiation factor 2
Synonyms: IF-2mt, 2410112O06Rik, 2310038D14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76784
HGNC: HGNC:7441
Homologene: 1840
Tas2r136
Name: taste receptor, type 2, member 136
Synonyms: mt2r52, Tas2r36
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353165
Homologene: 136304
Or10a3
Name: olfactory receptor family 10 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-11211854-11210853, MOR268-5, Olfr518
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258303
HGNC: HGNC:8162
Homologene: 133601
Adck5
Name: aarF domain containing kinase 5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268822
Homologene: 34378
Cnn1
Name: calponin 1
Synonyms: CnnI, calponin h1, CN
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12797
VEGA: 9
HGNC: HGNC:2155
Homologene: 995
Pomk
Name: protein-O-mannose kinase
Synonyms: Sgk196, 4930444A02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74653
Homologene: 12580
Ubiad1
Name: UbiA prenyltransferase domain containing 1
Synonyms: Tere1, 1200002M06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71707
Homologene: 8336
2310039H08Rik
Name: RIKEN cDNA 2310039H08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 67101
VEGA: 17
Homologene: 87029
Or12d15
Name: olfactory receptor family 12 subfamily D member 15
Synonyms: MOR250-7, GA_x6K02T2PSCP-1843460-1844386, Olfr105
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257893
Mxd4
Name: Max dimerization protein 4
Synonyms: Mad4, 2810410A03Rik, bHLHc12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17122
Homologene: 4712
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 51,778,537 bp
  • G to A, chromosome 1 at 72,160,958 bp
  • TAAAAAAAAA to TAAAAAAA, chromosome 1 at 88,215,928 bp
  • G to T, chromosome 1 at 136,225,442 bp
  • T to C, chromosome 1 at 139,510,544 bp
  • A to T, chromosome 1 at 179,770,634 bp
  • A to T, chromosome 2 at 30,069,098 bp
  • T to C, chromosome 2 at 150,971,190 bp
  • G to T, chromosome 3 at 90,458,208 bp
  • T to G, chromosome 4 at 98,676,193 bp
  • C to A, chromosome 4 at 111,657,239 bp
  • A to G, chromosome 4 at 148,436,435 bp
  • G to A, chromosome 5 at 13,473,406 bp
  • T to C, chromosome 5 at 31,263,812 bp
  • T to C, chromosome 5 at 34,177,730 bp
  • G to A, chromosome 5 at 113,077,603 bp
  • A to G, chromosome 5 at 120,756,238 bp
  • T to C, chromosome 5 at 137,297,165 bp
  • T to A, chromosome 5 at 137,870,966 bp
  • A to G, chromosome 6 at 47,576,615 bp
  • T to A, chromosome 6 at 73,212,616 bp
  • T to C, chromosome 6 at 116,413,507 bp
  • T to A, chromosome 6 at 125,120,363 bp
  • A to G, chromosome 6 at 132,778,080 bp
  • C to A, chromosome 7 at 45,076,329 bp
  • T to C, chromosome 7 at 97,386,919 bp
  • C to T, chromosome 7 at 108,880,998 bp
  • A to G, chromosome 8 at 25,983,016 bp
  • A to G, chromosome 8 at 61,549,815 bp
  • T to A, chromosome 8 at 68,895,737 bp
  • T to C, chromosome 8 at 106,552,936 bp
  • T to C, chromosome 8 at 110,485,419 bp
  • A to G, chromosome 9 at 14,811,834 bp
  • A to T, chromosome 9 at 22,105,410 bp
  • GGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTG, chromosome 9 at 27,088,053 bp
  • A to G, chromosome 9 at 117,998,940 bp
  • G to T, chromosome 11 at 29,536,964 bp
  • A to G, chromosome 11 at 36,069,503 bp
  • A to G, chromosome 11 at 87,137,603 bp
  • G to A, chromosome 15 at 76,595,580 bp
  • G to A, chromosome 16 at 25,987,266 bp
  • T to C, chromosome 17 at 32,143,283 bp
  • T to A, chromosome 17 at 37,382,924 bp
  • C to A, chromosome 17 at 46,773,036 bp
  • A to T, chromosome 18 at 38,589,975 bp
  • T to A, chromosome 19 at 12,428,688 bp
  • T to C, chromosome 19 at 13,814,960 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5343 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042922-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.