Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5347Btlr/Mmmh
Stock Number:
042926-MU
Citation ID:
RRID:MMRRC_042926-MU
Other Names:
R5347 (G1), C57BL/6J-MtgxR5347Btlr
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Acvr2a
Name: activin receptor IIA
Synonyms: ActRIIa, tActRII, Acvr2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11480
HGNC: HGNC:173
Homologene: 20391
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Fbxl3
Name: F-box and leucine-rich repeat protein 3
Synonyms: Fbl3a, Fbxl3a, Ovtm, Play68
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50789
Homologene: 8127
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Tcf12
Name: transcription factor 12
Synonyms: ME1, ALF1, HEB, HTF4, HTF-4, REB, bHLHb20, HEBAlt
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21406
Homologene: 40774
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 44,057,795 bp
  • T to C, chromosome 1 at 64,819,990 bp
  • C to T, chromosome 1 at 139,337,371 bp
  • A to G, chromosome 1 at 151,807,451 bp
  • A to G, chromosome 1 at 162,713,382 bp
  • A to T, chromosome 1 at 193,128,379 bp
  • G to A, chromosome 2 at 4,763,241 bp
  • T to A, chromosome 2 at 30,069,410 bp
  • G to A, chromosome 2 at 35,037,624 bp
  • A to G, chromosome 2 at 48,892,154 bp
  • T to C, chromosome 2 at 74,573,591 bp
  • A to G, chromosome 2 at 120,730,065 bp
  • T to A, chromosome 2 at 140,154,881 bp
  • A to G, chromosome 2 at 155,672,988 bp
  • A to T, chromosome 3 at 55,142,319 bp
  • A to C, chromosome 3 at 56,040,876 bp
  • T to C, chromosome 3 at 93,773,783 bp
  • A to G, chromosome 3 at 116,791,165 bp
  • T to A, chromosome 4 at 141,471,485 bp
  • T to C, chromosome 5 at 121,304,448 bp
  • T to C, chromosome 5 at 124,578,799 bp
  • C to T, chromosome 6 at 30,118,968 bp
  • T to G, chromosome 6 at 122,081,592 bp
  • A to G, chromosome 6 at 122,880,747 bp
  • A to G, chromosome 6 at 142,086,599 bp
  • A to T, chromosome 7 at 4,967,423 bp
  • A to C, chromosome 7 at 7,182,535 bp
  • G to T, chromosome 7 at 47,556,167 bp
  • A to G, chromosome 7 at 55,823,685 bp
  • G to T, chromosome 7 at 109,026,771 bp
  • G to A, chromosome 7 at 128,141,302 bp
  • T to C, chromosome 7 at 133,675,922 bp
  • A to G, chromosome 7 at 141,209,624 bp
  • G to A, chromosome 8 at 13,414,478 bp
  • T to A, chromosome 8 at 77,210,748 bp
  • A to G, chromosome 8 at 91,391,479 bp
  • A to G, chromosome 8 at 94,092,550 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 109,904,456 bp
  • G to A, chromosome 8 at 122,335,530 bp
  • A to G, chromosome 8 at 122,862,063 bp
  • T to G, chromosome 9 at 7,129,727 bp
  • A to T, chromosome 9 at 36,120,716 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • G to A, chromosome 9 at 71,885,243 bp
  • A to G, chromosome 9 at 75,295,205 bp
  • A to G, chromosome 9 at 107,514,114 bp
  • A to G, chromosome 10 at 80,410,211 bp
  • T to A, chromosome 11 at 99,282,730 bp
  • T to C, chromosome 12 at 114,764,756 bp
  • A to G, chromosome 12 at 118,848,511 bp
  • C to T, chromosome 13 at 23,908,817 bp
  • T to C, chromosome 13 at 33,257,784 bp
  • A to T, chromosome 14 at 41,158,829 bp
  • A to T, chromosome 14 at 47,268,724 bp
  • A to C, chromosome 14 at 103,083,294 bp
  • T to A, chromosome 16 at 4,694,482 bp
  • G to A, chromosome 16 at 22,053,660 bp
  • A to G, chromosome 16 at 94,267,524 bp
  • T to A, chromosome 16 at 94,429,620 bp
  • C to T, chromosome 17 at 5,291,057 bp
  • T to C, chromosome 17 at 37,574,727 bp
  • A to G, chromosome 17 at 71,749,935 bp
  • T to A, chromosome 17 at 73,925,032 bp
  • G to A, chromosome 18 at 65,970,086 bp
  • G to T, chromosome 18 at 77,366,541 bp
  • T to A, chromosome 19 at 8,618,553 bp
  • A to G, chromosome 19 at 43,441,862 bp
  • A to T, chromosome 19 at 55,088,837 bp
  • A to G, chromosome 19 at 57,378,619 bp
  • T to C, chromosome Y at 725,950 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5347 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042926-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.