Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5364Btlr/Mmmh
Stock Number:
042942-MU
Citation ID:
RRID:MMRRC_042942-MU
Other Names:
R5364 (G1), C57BL/6J-MtgxR5364Btlr
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Tbx21
Name: T-box 21
Synonyms: Tblym, TBT1, T-bet, Tbet
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57765
Homologene: 8353
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Kat2b
Name: K(lysine) acetyltransferase 2B
Synonyms: A930006P13Rik, Pcaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18519
HGNC: HGNC:8638
Homologene: 20834
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Ghitm
Name: growth hormone inducible transmembrane protein
Synonyms: PTD010, 1010001P14Rik, C77840, Tmbim5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66092
VEGA: 14
Homologene: 8667
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 45,925,223 bp
  • T to G, chromosome 1 at 132,357,796 bp
  • A to G, chromosome 1 at 180,067,182 bp
  • T to A, chromosome 2 at 20,849,722 bp
  • T to C, chromosome 2 at 23,133,653 bp
  • T to C, chromosome 2 at 36,859,994 bp
  • C to T, chromosome 2 at 76,908,516 bp
  • T to C, chromosome 2 at 76,977,114 bp
  • G to A, chromosome 2 at 127,141,819 bp
  • A to G, chromosome 2 at 131,054,472 bp
  • A to G, chromosome 3 at 40,977,223 bp
  • A to C, chromosome 3 at 55,255,945 bp
  • A to G, chromosome 3 at 79,481,168 bp
  • A to T, chromosome 3 at 87,758,361 bp
  • A to T, chromosome 3 at 89,345,595 bp
  • A to T, chromosome 3 at 99,352,192 bp
  • A to C, chromosome 3 at 122,529,632 bp
  • G to T, chromosome 3 at 126,780,420 bp
  • T to A, chromosome 4 at 24,496,882 bp
  • T to A, chromosome 4 at 28,950,557 bp
  • T to A, chromosome 4 at 106,691,643 bp
  • T to C, chromosome 4 at 129,609,170 bp
  • G to A, chromosome 4 at 139,052,504 bp
  • G to A, chromosome 4 at 143,273,956 bp
  • A to G, chromosome 5 at 23,752,285 bp
  • C to A, chromosome 5 at 34,466,253 bp
  • A to T, chromosome 5 at 72,136,762 bp
  • T to C, chromosome 5 at 72,667,900 bp
  • T to C, chromosome 5 at 120,600,267 bp
  • T to A, chromosome 5 at 121,500,883 bp
  • T to C, chromosome 5 at 138,299,407 bp
  • G to A, chromosome 5 at 145,151,431 bp
  • T to C, chromosome 6 at 4,756,128 bp
  • T to C, chromosome 6 at 31,496,712 bp
  • A to T, chromosome 6 at 41,202,830 bp
  • T to A, chromosome 6 at 56,985,598 bp
  • A to G, chromosome 6 at 92,193,977 bp
  • T to G, chromosome 6 at 118,656,543 bp
  • T to C, chromosome 6 at 125,357,393 bp
  • A to G, chromosome 6 at 129,899,353 bp
  • G to T, chromosome 6 at 145,955,621 bp
  • T to A, chromosome 7 at 12,670,903 bp
  • T to A, chromosome 7 at 23,418,328 bp
  • C to G, chromosome 7 at 27,578,767 bp
  • C to A, chromosome 7 at 28,611,023 bp
  • T to A, chromosome 7 at 30,355,653 bp
  • C to A, chromosome 7 at 30,546,148 bp
  • T to C, chromosome 7 at 41,650,127 bp
  • T to A, chromosome 7 at 45,936,332 bp
  • C to A, chromosome 7 at 49,848,806 bp
  • C to T, chromosome 7 at 105,619,069 bp
  • T to C, chromosome 7 at 118,698,651 bp
  • A to T, chromosome 7 at 131,560,738 bp
  • T to C, chromosome 7 at 144,637,204 bp
  • A to G, chromosome 8 at 94,074,395 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to T, chromosome 8 at 121,806,636 bp
  • G to T, chromosome 9 at 22,575,196 bp
  • G to A, chromosome 9 at 37,417,333 bp
  • A to T, chromosome 9 at 64,235,539 bp
  • A to T, chromosome 9 at 83,790,023 bp
  • A to T, chromosome 9 at 109,092,120 bp
  • A to G, chromosome 10 at 24,877,026 bp
  • T to C, chromosome 10 at 103,393,508 bp
  • A to T, chromosome 11 at 20,100,797 bp
  • T to C, chromosome 11 at 60,720,128 bp
  • A to G, chromosome 11 at 65,881,696 bp
  • A to G, chromosome 11 at 84,121,147 bp
  • A to G, chromosome 11 at 87,237,181 bp
  • T to A, chromosome 11 at 94,416,858 bp
  • C to T, chromosome 11 at 97,101,478 bp
  • C to A, chromosome 11 at 117,864,194 bp
  • A to T, chromosome 12 at 33,051,008 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • A to T, chromosome 12 at 101,771,364 bp
  • C to A, chromosome 12 at 112,910,534 bp
  • G to A, chromosome 13 at 13,183,042 bp
  • A to G, chromosome 13 at 13,656,854 bp
  • T to A, chromosome 13 at 38,210,189 bp
  • A to T, chromosome 13 at 67,257,948 bp
  • G to T, chromosome 14 at 37,125,199 bp
  • A to T, chromosome 14 at 37,125,217 bp
  • T to A, chromosome 14 at 56,920,645 bp
  • G to A, chromosome 15 at 27,659,945 bp
  • A to C, chromosome 15 at 83,314,361 bp
  • C to A, chromosome 15 at 89,082,804 bp
  • A to T, chromosome 16 at 16,886,970 bp
  • A to G, chromosome 16 at 17,573,363 bp
  • A to G, chromosome 16 at 20,733,148 bp
  • G to T, chromosome 16 at 22,600,461 bp
  • T to C, chromosome 17 at 17,970,544 bp
  • C to T, chromosome 17 at 35,930,432 bp
  • T to C, chromosome 17 at 45,664,727 bp
  • G to A, chromosome 17 at 46,305,651 bp
  • T to C, chromosome 17 at 53,659,404 bp
  • A to G, chromosome 17 at 56,982,000 bp
  • T to A, chromosome 18 at 37,422,179 bp
  • A to G, chromosome 18 at 37,443,508 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5364 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042942-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.