Strain Name:
C57BL/6J-MtgxR5364Btlr/Mmmh
Stock Number:
042942-MU
Citation ID:
RRID:MMRRC_042942-MU
Other Names:
R5364 (G1), C57BL/6J-MtgxR5364Btlr
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Tbx21
Name: T-box 21
Synonyms: Tblym, TBT1, T-bet, Tbet
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 57765
Homologene: 8353
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Kat2b
Name: K(lysine) acetyltransferase 2B
Synonyms: A930006P13Rik, Pcaf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18519
HGNC: HGNC:8638
Homologene: 20834
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Ghitm
Name: growth hormone inducible transmembrane protein
Synonyms: PTD010, 1010001P14Rik, C77840, Tmbim5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66092
VEGA: 14
Homologene: 8667
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101772
Homologene: 75079
Tmem63b
Name: transmembrane protein 63b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224807
Homologene: 101682
Ppm1e
Name: protein phosphatase 1E (PP2C domain containing)
Synonyms: PP2CH, POPX1, B930008A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320472
Homologene: 22848
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71435
Homologene: 10822
Top3b
Name: topoisomerase (DNA) III beta
Synonyms: Topo III beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21976
Homologene: 2923
Klhdc4
Name: kelch domain containing 4
Synonyms: G430025P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234825
Homologene: 69234
Bub3
Name: BUB3 mitotic checkpoint protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12237
HGNC: HGNC:1151
Homologene: 3470
Actr2
Name: ARP2 actin-related protein 2
Synonyms: 4921510D23Rik, D6Ertd746e, Arp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66713
HGNC: HGNC:169
Homologene: 4181
Zmym2
Name: zinc finger, MYM-type 2
Synonyms: SCLL, RAMP, MYM, FIM, Zfp198
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 76007
VEGA: 14
Homologene: 12631
Prmt3
Name: protein arginine N-methyltransferase 3
Synonyms: 2410018A17Rik, 2010005E20Rik, Hrmt1l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71974
Homologene: 24255
Ppp1r10
Name: protein phosphatase 1, regulatory subunit 10
Synonyms: 2610025H06Rik, D17Ertd808e, PNUTS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 52040
HGNC: HGNC:9284
Homologene: 2033
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212377
Homologene: 18874
Mastl
Name: microtubule associated serine/threonine kinase-like
Synonyms: THC2, 2700091H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67121
Homologene: 12086
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19649
Homologene: 32119
Arfgap3
Name: ADP-ribosylation factor GTPase activating protein 3
Synonyms: 1810004P07Rik, 1810035F16Rik, 0610009H19Rik, 9130416J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66251
VEGA: 15
HGNC: HGNC:661
Homologene: 134103
Bbs9
Name: Bardet-Biedl syndrome 9
Synonyms: EST 3159894, E130103I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319845
Homologene: 44480
Fam193a
Name: family with sequence homology 193, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231128
Homologene: 2746
Flii
Name: flightless I actin binding protein
Synonyms: 3632430F08Rik, Fliih
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14248
HGNC: HGNC:3750
Homologene: 11092
Iqcd
Name: IQ motif containing D
Synonyms: 4933433C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75732
Homologene: 49921
Adam33
Name: a disintegrin and metallopeptidase domain 33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110751
Homologene: 11881
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
2310022A10Rik
Name: RIKEN cDNA 2310022A10 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 66367
Homologene: 35272
Snrnp48
Name: small nuclear ribonucleoprotein 48 (U11/U12)
Synonyms: 1110050F08Rik, 6530403A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67797
VEGA: 13
Homologene: 12191
Med23
Name: mediator complex subunit 23
Synonyms: ESTM7, 3000002A17Rik, X83317, Crsp3, Sur2, sno
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Stag3
Name: STAG3 cohesin complex component
Synonyms: stromalin 3, SA-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 50878
Homologene: 40844
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 170676
Homologene: 116067
Adam15
Name: ADAM metallopeptidase domain 15
Synonyms: metargidin, MDC15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11490
HGNC: HGNC:193
Homologene: 2829
Pdpn
Name: podoplanin
Synonyms: PA2.26, OTS-8, T1alpha, T1a, Gp38, RANDAM-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14726
Homologene: 4729
Tnfrsf1a
Name: tumor necrosis factor receptor superfamily, member 1a
Synonyms: TNF receptor alpha chain, CD120a, TNF-R1, p55, TNF-R55, TNFRp55, Tnfr1, TNF-R-I, TNFR60, TNFAR, p55-R, TNFRI, TNF-alpha-R1, TNF-alphaR1, TNFalpha-R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21937
Homologene: 828
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Mroh7
Name: maestro heat-like repeat family member 7
Synonyms: LOC381538, Gm1027, Heatr8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381538
Homologene: 19633
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: DMPK-like, A930014J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Or1n1
Name: olfactory receptor family 1 subfamily N member 1
Synonyms: GA_x6K02T2NLDC-33554926-33553994, MOR127-2, Olfr351
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258944
HGNC: HGNC:8221
Homologene: 10583
Pcdhb11
Name: protocadherin beta 11
Synonyms: Pcdhb5E, PcdhbK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93882
HGNC: HGNC:8690
Homologene: 62178
Proser3
Name: proline and serine rich 3
Synonyms: BC053749
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 333193
Homologene: 116064
Pus7
Name: pseudouridylate synthase 7
Synonyms: C330017I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 78697
Homologene: 6998
Tbx15
Name: T-box 15
Synonyms: Tbx8, de, Tbx14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 21384
Homologene: 7967
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Dgkg
Name: diacylglycerol kinase, gamma
Synonyms: Dagk3, E430001K23Rik, 2900055E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 110197
HGNC: HGNC:2853
Homologene: 1029
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Cdhr3
Name: cadherin-related family member 3
Synonyms: 1110049B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68764
VEGA: 12
Homologene: 45146
Camk2d
Name: calcium/calmodulin-dependent protein kinase II, delta
Synonyms: CaMK II, 2810011D23Rik, 8030469K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 108058
HGNC: HGNC:1462
Homologene: 55561
Uchl4
Name: ubiquitin carboxyl-terminal esterase L4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 93841
VEGA: 9
Dclk1
Name: doublecortin-like kinase 1
Synonyms: CPG16, DCLK, 1700113D08Rik, 2810480F11Rik, Dcl, Click-I, Dcamkl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13175
HGNC: HGNC:2700
Homologene: 130530
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73182
Homologene: 12492
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Acer1
Name: alkaline ceramidase 1
Synonyms: 2310024P18Rik, Cer1, Asah3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171168
VEGA: 17
Homologene: 15853
Slc7a4
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224022
Homologene: 20883
Jag2
Name: jagged 2
Synonyms: Serh, D12Ggc2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16450
VEGA: 12
HGNC: HGNC:6189
Homologene: 1677
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214321
Homologene: 86950
Dcdc2b
Name: doublecortin domain containing 2b
Synonyms: LOC384062, Gm12964
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100504491
Homologene: 82651
Ccdc51
Name: coiled-coil domain containing 51
Synonyms: 5730568A12Rik, Mitok
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66658
Homologene: 11646
Gabrb1
Name: gamma-aminobutyric acid type A receptor subunit beta 1
Synonyms: Gabrb-1, B230208N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14400
HGNC: HGNC:4081
Homologene: 20221
Tmco4
Name: transmembrane and coiled-coil domains 4
Synonyms: 4632413C14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77056
Homologene: 57112
Gde1
Name: glycerophosphodiester phosphodiesterase 1
Synonyms: 1200003M13Rik, MIR16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56209
Homologene: 41149
Tmcc2
Name: transmembrane and coiled-coil domains 2
Synonyms: 1110063G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68875
Homologene: 8905
Vmn2r55
Name: vomeronasal 2, receptor 55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100042499
Homologene: 104040
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Rbsn
Name: rabenosyn, RAB effector
Synonyms: 5330426D11Rik, Rabenosyn-5, Zfyve20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78287
Homologene: 41477
Acp7
Name: acid phosphatase 7, tartrate resistant
Synonyms: C330005M16Rik, Papl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101744
Homologene: 23924
Prl2c5
Name: prolactin family 2, subfamily c, member 5
Synonyms: MRP-4, PLF-4, Mrpplf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 107849
HGNC: HGNC:9445
Homologene: 40763
Zfp788
Name: zinc finger protein 788
Synonyms: 2810426N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67607
Homologene: 137363
Elovl4
Name: ELOVL fatty acid elongase 4
Synonyms: elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 83603
Homologene: 41488
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23968
Homologene: 65105
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329679
Homologene: 46417
Klra5
Name: killer cell lectin-like receptor, subfamily A, member 5
Synonyms: Ly49e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16636
Homologene: 110821
Vmn1r5
Name: vomeronasal 1 receptor 5
Synonyms: V1rc19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171192
Homologene: 128340
Itpripl1
Name: inositol 1,4,5-triphosphate receptor interacting protein-like 1
Synonyms: 1700041B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73338
Homologene: 77641
Otulinl
Name: OTU deubiquitinase with linear linkage specificity like
Synonyms: Fam105a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223433
VEGA: 15
Homologene: 41302
Trabd
Name: TraB domain containing
Synonyms: 5730502D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 67976
Homologene: 36427
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Fbln5
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 23876
VEGA: 12
HGNC: HGNC:3602
Homologene: 38170
Slc40a1
Name: solute carrier family 40 (iron-regulated transporter), member 1
Synonyms: Ol5, ferroportin1, IREG1, FPN1, metal transporting protein 1, MTP1, Slc11a3, Dusg, Pcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53945
Homologene: 40959
Larp1b
Name: La ribonucleoprotein 1B
Synonyms: 1700108L22Rik, 4933421B21Rik, Larp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 214048
Homologene: 103869
Tmem235
Name: transmembrane protein 235
Synonyms: Tmem235, Gm12581, Cldn27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 546519
Homologene: 53069
Lrfn3
Name: leucine rich repeat and fibronectin type III domain containing 3
Synonyms: A530045B06Rik, SALM4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233067
Homologene: 11558
Trbv21
Name: T cell receptor beta, variable 21
Synonyms: Tcrb-V19, Gm16778
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 100124686
Bbs2
Name: Bardet-Biedl syndrome 2
Synonyms: 2410125H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67378
HGNC: HGNC:967
Homologene: 12122
Nipal1
Name: NIPA-like domain containing 1
Synonyms: 3830408G10Rik, Npal1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70701
Homologene: 28165
Odad1
Name: outer dynein arm docking complex subunit 1
Synonyms: Ccdc114
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 211535
Homologene: 128610
Trim3
Name: tripartite motif-containing 3
Synonyms: BERP1, HAC1, Rnf22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 55992
Homologene: 21290
Tada2a
Name: transcriptional adaptor 2A
Synonyms: D030022J10Rik, Tada2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217031
Homologene: 38834
Fpr3
Name: formyl peptide receptor 3
Synonyms: Lxa4r, LXA4-R, Fprl1, Fpr-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14294
Adam1b
Name: a disintegrin and metallopeptidase domain 1b
Synonyms: Ftna, PH-30 alpha, fertilin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 280667
Homologene: 136485
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Ptcd1
Name: pentatricopeptide repeat domain 1
Synonyms: 1110069M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71799
Homologene: 33161
Sspnos
Name: sarcospan, opposite strand
Synonyms: Gm15705
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 45,925,223 bp
  • T to G, chromosome 1 at 132,357,796 bp
  • A to G, chromosome 1 at 180,067,182 bp
  • T to A, chromosome 2 at 20,849,722 bp
  • T to C, chromosome 2 at 23,133,653 bp
  • T to C, chromosome 2 at 36,859,994 bp
  • C to T, chromosome 2 at 76,908,516 bp
  • T to C, chromosome 2 at 76,977,114 bp
  • G to A, chromosome 2 at 127,141,819 bp
  • A to G, chromosome 2 at 131,054,472 bp
  • A to G, chromosome 3 at 40,977,223 bp
  • A to C, chromosome 3 at 55,255,945 bp
  • A to G, chromosome 3 at 79,481,168 bp
  • A to T, chromosome 3 at 87,758,361 bp
  • A to T, chromosome 3 at 89,345,595 bp
  • A to T, chromosome 3 at 99,352,192 bp
  • A to C, chromosome 3 at 122,529,632 bp
  • G to T, chromosome 3 at 126,780,420 bp
  • T to A, chromosome 4 at 24,496,882 bp
  • T to A, chromosome 4 at 28,950,557 bp
  • T to A, chromosome 4 at 106,691,643 bp
  • T to C, chromosome 4 at 129,609,170 bp
  • G to A, chromosome 4 at 139,052,504 bp
  • G to A, chromosome 4 at 143,273,956 bp
  • A to G, chromosome 5 at 23,752,285 bp
  • C to A, chromosome 5 at 34,466,253 bp
  • A to T, chromosome 5 at 72,136,762 bp
  • T to C, chromosome 5 at 72,667,900 bp
  • T to C, chromosome 5 at 120,600,267 bp
  • T to A, chromosome 5 at 121,500,883 bp
  • T to C, chromosome 5 at 138,299,407 bp
  • G to A, chromosome 5 at 145,151,431 bp
  • T to C, chromosome 6 at 4,756,128 bp
  • T to C, chromosome 6 at 31,496,712 bp
  • A to T, chromosome 6 at 41,202,830 bp
  • T to A, chromosome 6 at 56,985,598 bp
  • A to G, chromosome 6 at 92,193,977 bp
  • T to G, chromosome 6 at 118,656,543 bp
  • T to C, chromosome 6 at 125,357,393 bp
  • A to G, chromosome 6 at 129,899,353 bp
  • G to T, chromosome 6 at 145,955,621 bp
  • T to A, chromosome 7 at 12,670,903 bp
  • T to A, chromosome 7 at 23,418,328 bp
  • C to G, chromosome 7 at 27,578,767 bp
  • C to A, chromosome 7 at 28,611,023 bp
  • T to A, chromosome 7 at 30,355,653 bp
  • C to A, chromosome 7 at 30,546,148 bp
  • T to C, chromosome 7 at 41,650,127 bp
  • T to A, chromosome 7 at 45,936,332 bp
  • C to A, chromosome 7 at 49,848,806 bp
  • C to T, chromosome 7 at 105,619,069 bp
  • T to C, chromosome 7 at 118,698,651 bp
  • A to T, chromosome 7 at 131,560,738 bp
  • T to C, chromosome 7 at 144,637,204 bp
  • A to G, chromosome 8 at 94,074,395 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to T, chromosome 8 at 121,806,636 bp
  • G to T, chromosome 9 at 22,575,196 bp
  • G to A, chromosome 9 at 37,417,333 bp
  • A to T, chromosome 9 at 64,235,539 bp
  • A to T, chromosome 9 at 83,790,023 bp
  • A to T, chromosome 9 at 109,092,120 bp
  • A to G, chromosome 10 at 24,877,026 bp
  • T to C, chromosome 10 at 103,393,508 bp
  • A to T, chromosome 11 at 20,100,797 bp
  • T to C, chromosome 11 at 60,720,128 bp
  • A to G, chromosome 11 at 65,881,696 bp
  • A to G, chromosome 11 at 84,121,147 bp
  • A to G, chromosome 11 at 87,237,181 bp
  • T to A, chromosome 11 at 94,416,858 bp
  • C to T, chromosome 11 at 97,101,478 bp
  • C to A, chromosome 11 at 117,864,194 bp
  • A to T, chromosome 12 at 33,051,008 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • A to T, chromosome 12 at 101,771,364 bp
  • C to A, chromosome 12 at 112,910,534 bp
  • G to A, chromosome 13 at 13,183,042 bp
  • A to G, chromosome 13 at 13,656,854 bp
  • T to A, chromosome 13 at 38,210,189 bp
  • A to T, chromosome 13 at 67,257,948 bp
  • G to T, chromosome 14 at 37,125,199 bp
  • A to T, chromosome 14 at 37,125,217 bp
  • T to A, chromosome 14 at 56,920,645 bp
  • G to A, chromosome 15 at 27,659,945 bp
  • A to C, chromosome 15 at 83,314,361 bp
  • C to A, chromosome 15 at 89,082,804 bp
  • A to T, chromosome 16 at 16,886,970 bp
  • A to G, chromosome 16 at 17,573,363 bp
  • A to G, chromosome 16 at 20,733,148 bp
  • G to T, chromosome 16 at 22,600,461 bp
  • T to C, chromosome 17 at 17,970,544 bp
  • C to T, chromosome 17 at 35,930,432 bp
  • T to C, chromosome 17 at 45,664,727 bp
  • G to A, chromosome 17 at 46,305,651 bp
  • T to C, chromosome 17 at 53,659,404 bp
  • A to G, chromosome 17 at 56,982,000 bp
  • T to A, chromosome 18 at 37,422,179 bp
  • A to G, chromosome 18 at 37,443,508 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5364 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042942-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.