Strain Name:
C57BL/6J-MtgxR5382Btlr/Mmmh
Stock Number:
042957-MU
Citation ID:
RRID:MMRRC_042957-MU
Other Names:
R5382 (G1), C57BL/6J-MtgxR5382Btlr
Major Collection:

Strain Information

Th
Name: tyrosine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21823
Homologene: 307
Otx1
Name: orthodenticle homeobox 1
Synonyms: A730044F23Rik, jv
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18423
HGNC: HGNC:8521
Homologene: 7875
Rnf10
Name: ring finger protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50849
Homologene: 40990
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Exoc6
Name: exocyst complex component 6
Synonyms: msec15, 4833405E05Rik, Sec15, Sec15l1, hbd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107371
VEGA: 19
Homologene: 41305
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Brd1
Name: bromodomain containing 1
Synonyms: 1110059H06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223770
HGNC: HGNC:1102
Homologene: 40956
Arhgap32
Name: Rho GTPase activating protein 32
Synonyms: p200RhoGAP, GC-GAP, PX-RICS, 3426406O18Rik, Grit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330914
Homologene: 8812
Cbl
Name: Casitas B-lineage lymphoma
Synonyms: Cbl-2, c-Cbl, 4732447J05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12402
HGNC: HGNC:1541
Homologene: 3802
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Wars1
Name: tryptophanyl-tRNA synthetase1
Synonyms: Wars
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22375
Homologene: 3084
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Numb
Name: NUMB endocytic adaptor protein
Synonyms: m-numb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18222
HGNC: HGNC:8060
Homologene: 2775
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, 5033405M01Rik, B430107L16Rik, 9630025C19Rik, Rab6ip2, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Gpr183
Name: G protein-coupled receptor 183
Synonyms: Ebi2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 321019
VEGA: 14
HGNC: HGNC:3128
Homologene: 28066
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 383435
Homologene: 138453
Zfp644
Name: zinc finger protein 644
Synonyms: 1110068L01Rik, BM-005, Zep-2, D5Ertd689e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52397
Homologene: 12971
Cp
Name: ceruloplasmin
Synonyms: D3Ertd555e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12870
HGNC: HGNC:2295
Homologene: 75
Cyp7b1
Name: cytochrome P450, family 7, subfamily b, polypeptide 1
Synonyms: hct-1, D3Ertd552e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13123
HGNC: HGNC:2652
Homologene: 3544
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Gpr63
Name: G protein-coupled receptor 63
Synonyms: PSP24beta
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 81006
Homologene: 12759
Rab11fip4
Name: RAB11 family interacting protein 4 (class II)
Synonyms: RAB11-FIP4, A730072L08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268451
Homologene: 8803
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Actn2
Name: actinin alpha 2
Synonyms: 1110008F24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11472
HGNC: HGNC:164
Homologene: 31016
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
BC034090
Name: cDNA sequence BC034090
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 207792
Homologene: 19490
Phactr1
Name: phosphatase and actin regulator 1
Synonyms: Rpel1, 9630030F18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218194
Homologene: 33597
Grb14
Name: growth factor receptor bound protein 14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50915
HGNC: HGNC:4565
Homologene: 3303
Padi6
Name: peptidyl arginine deiminase, type VI
Synonyms: ePAD, Padi5, Pad6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242726
Homologene: 17695
Ciao3
Name: cytosolic iron-sulfur assembly component 3
Synonyms: 9030612I22Rik, Narfl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67563
Homologene: 6750
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Nell2
Name: NEL-like 2
Synonyms: mel91, A330108N19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54003
VEGA: 15
HGNC: HGNC:7751
Homologene: 4488
Pex16
Name: peroxisomal biogenesis factor 16
Synonyms: peroxisome biogenesis factor 16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18633
HGNC: HGNC:8857
Homologene: 3537
Acp7
Name: acid phosphatase 7, tartrate resistant
Synonyms: C330005M16Rik, Papl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101744
Homologene: 23924
Dctd
Name: dCMP deaminase
Synonyms: 6030466N05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320685
HGNC: HGNC:2710
Homologene: 55618
Tgfbrap1
Name: transforming growth factor, beta receptor associated protein 1
Synonyms: 3110018K12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73122
Homologene: 3141
Or8k27
Name: olfactory receptor family 8 subfamily K member 27
Synonyms: GA_x6K02T2Q125-47915274-47914333, MOR190-1, Olfr1065
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258403
Homologene: 74195
Rft1
Name: RFT1 homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328370
Homologene: 5343
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Or9g20
Name: olfactory receptor family 9 subfamily G member 20
Synonyms: GA_x6K02T2Q125-47278889-47277960, MOR213-9, Olfr1016
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257915
Homologene: 83133
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Kif28
Name: kinesin family member 28
Synonyms: LOC383592, Gm1305
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383592
Homologene: 130945
Or3a1
Name: olfactory receptor family 3 subfamily A member 1
Synonyms: GA_x6K02T2P1NL-4467421-4466474, MOR255-5, Olfr410
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258702
Homologene: 68262
Or4c114
Name: olfactory receptor family 4 subfamily C member 114
Synonyms: GA_x6K02T2Q125-50555603-50554668, MOR233-6, Olfr1219
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258901
Homologene: 27292
Mro
Name: maestro
Synonyms: 4933435E20Rik, 4930507C04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71263
Homologene: 41729
Prr23a2
Name: proline rich 23A, member 2
Synonyms: Gm6406
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 623186
Homologene: 67036
Krt79
Name: keratin 79
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223917
Homologene: 89169
Or6c66
Name: olfactory receptor family 6 subfamily C member 66
Synonyms: GA_x6K02T2PULF-11304679-11303744, MOR108-1, Olfr798
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258549
Homologene: 133881
Pimreg
Name: PICALM interacting mitotic regulator
Synonyms: 2610008F03Rik, CATS, 6720460F02Rik, Fam64a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 109212
Homologene: 10378
Trim3
Name: tripartite motif-containing 3
Synonyms: BERP1, HAC1, Rnf22
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55992
Homologene: 21290
Ndufaf1
Name: NADH:ubiquinone oxidoreductase complex assembly factor 1
Synonyms: CGI-65, CIA30, 2410001M24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69702
Homologene: 32289
Or5an11
Name: olfactory receptor family 5 subfamily AN member 11
Synonyms: GA_x6K02T2LL2P-1028-792, GA_x6K02T057QT-4025-4642, GA_x6K02T03CT6-1-477, MOR214-3, MOR214-3, Olfr245, Olfr232, Olfr235
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258681
Tacr2
Name: tachykinin receptor 2
Synonyms: Tac2r
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21337
VEGA: 10
Homologene: 55548
4932443L11Rik
Name: RIKEN cDNA 4932443L11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 78899
Gm20997
Name: predicted gene, 20997
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Igkv4-80
Name: immunoglobulin kappa variable 4-80
Synonyms: Gm16729
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545848
Gm26885
Name: predicted gene, 26885
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 102640282
VEGA: 17
Pcdhgc3
Name: protocadherin gamma subfamily C, 3
Synonyms: PC43, Pcdh2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93706
HGNC: HGNC:8716
Homologene: 31099
Cga
Name: glycoprotein hormones, alpha subunit
Synonyms: GPHalpha, alpha-GSU, Tsha, aGSU, alphaSU, alphaGSU
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12640
HGNC: HGNC:1885
Homologene: 587
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,075,865 bp
  • A to G, chromosome 1 at 155,225,603 bp
  • C to T, chromosome 1 at 179,700,282 bp
  • T to A, chromosome 2 at 64,914,734 bp
  • T to C, chromosome 2 at 85,800,148 bp
  • A to G, chromosome 2 at 86,445,316 bp
  • A to G, chromosome 2 at 89,074,735 bp
  • G to A, chromosome 2 at 92,377,530 bp
  • T to C, chromosome 2 at 119,660,412 bp
  • G to A, chromosome 2 at 156,267,497 bp
  • T to A, chromosome 3 at 18,097,221 bp
  • T to C, chromosome 3 at 19,978,925 bp
  • T to A, chromosome 4 at 25,007,952 bp
  • G to T, chromosome 4 at 34,904,048 bp
  • A to T, chromosome 4 at 58,850,934 bp
  • A to T, chromosome 4 at 140,731,210 bp
  • A to T, chromosome 5 at 106,634,869 bp
  • CGAGGAGGAGGAGGAGGAGGAGG to CGAGGAGGAGGAGGAGGAGG, chromosome 5 at 115,272,638 bp
  • A to C, chromosome 6 at 69,016,665 bp
  • T to A, chromosome 6 at 119,761,272 bp
  • C to T, chromosome 6 at 130,483,781 bp
  • G to T, chromosome 6 at 149,326,460 bp
  • A to T, chromosome 7 at 28,084,993 bp
  • G to A, chromosome 7 at 28,615,419 bp
  • A to C, chromosome 7 at 46,249,004 bp
  • C to A, chromosome 7 at 105,618,347 bp
  • A to G, chromosome 7 at 142,895,440 bp
  • A to G, chromosome 8 at 4,178,653 bp
  • C to T, chromosome 8 at 48,137,414 bp
  • A to T, chromosome 9 at 32,152,010 bp
  • C to T, chromosome 9 at 44,159,021 bp
  • T to A, chromosome 9 at 98,857,176 bp
  • T to C, chromosome 10 at 62,261,497 bp
  • T to A, chromosome 10 at 116,353,871 bp
  • T to A, chromosome 10 at 129,626,007 bp
  • C to A, chromosome 11 at 21,997,037 bp
  • A to G, chromosome 11 at 72,043,187 bp
  • T to A, chromosome 11 at 74,334,980 bp
  • T to C, chromosome 11 at 74,665,109 bp
  • A to G, chromosome 11 at 79,690,715 bp
  • A to G, chromosome 12 at 83,808,205 bp
  • A to T, chromosome 12 at 108,882,780 bp
  • T to A, chromosome 13 at 12,308,951 bp
  • T to C, chromosome 13 at 43,135,219 bp
  • T to C, chromosome 14 at 30,666,782 bp
  • T to C, chromosome 14 at 121,954,921 bp
  • A to T, chromosome 15 at 55,362,436 bp
  • G to A, chromosome 15 at 88,729,564 bp
  • A to T, chromosome 15 at 95,229,210 bp
  • A to T, chromosome 15 at 101,931,440 bp
  • A to G, chromosome 17 at 25,776,920 bp
  • T to A, chromosome 17 at 25,845,598 bp
  • A to G, chromosome 17 at 29,491,483 bp
  • A to T, chromosome 18 at 37,808,755 bp
  • G to A, chromosome 18 at 73,876,822 bp
  • G to T, chromosome 19 at 11,303,057 bp
  • A to T, chromosome 19 at 12,268,409 bp
  • A to T, chromosome 19 at 17,003,659 bp
  • A to G, chromosome 19 at 22,885,341 bp
  • T to C, chromosome 19 at 37,598,679 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5382 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042957-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.