Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5459Btlr/Mmmh
Stock Number:
043022-MU
Citation ID:
RRID:MMRRC_043022-MU
Other Names:
R5459 (G1), C57BL/6J-MtgxR5459Btlr
Major Collection:

Strain Information

Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Armc9
Name: armadillo repeat containing 9
Synonyms: 5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78795
Homologene: 11847
Polk
Name: polymerase (DNA directed), kappa
Synonyms: Dinb1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27015
VEGA: 13
HGNC: HGNC:9183
Homologene: 32140
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100929
Homologene: 7068
Tango6
Name: transport and golgi organization 6
Synonyms: Tmco7, Tango6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272538
Homologene: 52121
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,937,084 bp
  • A to C, chromosome 1 at 26,685,191 bp
  • A to G, chromosome 1 at 46,109,312 bp
  • A to G, chromosome 1 at 59,191,738 bp
  • G to A, chromosome 1 at 86,207,972 bp
  • A to G, chromosome 1 at 157,157,661 bp
  • G to A, chromosome 1 at 170,918,169 bp
  • C to T, chromosome 2 at 111,409,018 bp
  • T to C, chromosome 2 at 126,580,992 bp
  • T to A, chromosome 3 at 28,661,741 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 3 at 54,634,100 bp
  • A to G, chromosome 3 at 59,179,727 bp
  • G to A, chromosome 4 at 144,159,245 bp
  • A to G, chromosome 5 at 76,984,338 bp
  • A to T, chromosome 5 at 89,691,473 bp
  • A to G, chromosome 5 at 106,904,763 bp
  • A to C, chromosome 5 at 130,274,706 bp
  • T to A, chromosome 5 at 144,207,416 bp
  • C to T, chromosome 6 at 24,891,251 bp
  • T to A, chromosome 6 at 57,404,490 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 45,982,183 bp
  • A to G, chromosome 7 at 119,486,935 bp
  • A to T, chromosome 8 at 3,535,829 bp
  • T to A, chromosome 8 at 85,670,483 bp
  • T to A, chromosome 8 at 106,850,289 bp
  • T to C, chromosome 9 at 37,616,823 bp
  • T to C, chromosome 9 at 59,884,520 bp
  • C to T, chromosome 9 at 64,686,329 bp
  • T to C, chromosome 10 at 36,828,746 bp
  • T to A, chromosome 10 at 76,496,482 bp
  • T to C, chromosome 11 at 32,739,191 bp
  • G to T, chromosome 11 at 67,211,283 bp
  • T to A, chromosome 11 at 69,132,828 bp
  • A to T, chromosome 11 at 97,336,657 bp
  • A to G, chromosome 12 at 64,967,736 bp
  • G to A, chromosome 13 at 19,373,199 bp
  • A to T, chromosome 13 at 21,394,812 bp
  • C to T, chromosome 13 at 96,495,476 bp
  • A to G, chromosome 14 at 67,235,201 bp
  • A to G, chromosome 15 at 30,887,188 bp
  • C to T, chromosome 17 at 5,920,638 bp
  • C to T, chromosome 17 at 23,711,843 bp
  • A to G, chromosome 17 at 35,568,182 bp
  • T to A, chromosome 17 at 80,609,787 bp
  • A to G, chromosome 19 at 12,680,435 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5459 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043022-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.