Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5558Btlr/Mmmh
Stock Number:
043115-MU
Citation ID:
RRID:MMRRC_043115-MU
Other Names:
R5558 (G1), C57BL/6J-MtgxR5558Btlr
Major Collection:

Strain Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Khdc4
Name: KH domain containing 4, pre-mRNA splicing factor
Synonyms: 2810403A07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74200
Homologene: 41761
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Zfp384
Name: zinc finger protein 384
Synonyms: C130073D16Rik, Ciz, Nmp4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269800
Homologene: 15849
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Sgrp23, GENA202, Gena201, Gars
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
R3hdm2
Name: R3H domain containing 2
Synonyms: 1300003K24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71750
Homologene: 8954
Mrps5
Name: mitochondrial ribosomal protein S5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77721
Homologene: 32726
Adam8
Name: a disintegrin and metallopeptidase domain 8
Synonyms: CD156, MS2, E430039A18Rik, CD156a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11501
HGNC: HGNC:215
Homologene: 74384
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Zc3h18
Name: zinc finger CCCH-type containing 18
Synonyms: 1190001B23Rik, 5830416A07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76014
Homologene: 44894
Lca5
Name: Leber congenital amaurosis 5 (human)
Synonyms: 5730406O13Rik, ORF64, 4930431B11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75782
Homologene: 32718
Acvr1
Name: activin A receptor, type 1
Synonyms: ActR-I, ALK2, Acvr, Acvrlk2, ActRIA, SKR1, Tsk7L, D330013D15Rik, Alk8, Alk-2, Acvr1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11477
HGNC: HGNC:171
Homologene: 7
Myo19
Name: myosin XIX
Synonyms: 1110055A02Rik, Myohd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66196
Homologene: 49819
Lap3
Name: leucine aminopeptidase 3
Synonyms: Pep-S, Pep-7, LAP, peptidase S, Pep7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66988
Homologene: 41072
Phactr4
Name: phosphatase and actin regulator 4
Synonyms: C330013F19Rik, 3110001B12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100169
Homologene: 41537
Dph1
Name: diphthamide biosynthesis 1
Synonyms: Ovca1, 4930488F09Rik, Dph2l1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 116905
HGNC: HGNC:3003
Homologene: 1059
Tbc1d2
Name: TBC1 domain family, member 2
Synonyms: LOC381605, PARIS-1, PARIS1, A630005A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381605
Homologene: 10190
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: Nna1, 2900054O13Rik, 4930445M19Rik, 1700020N17Rik, 5730402G09Rik, 2310001G17Rik, Ccp1, atms
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67269
Homologene: 9067
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Pgm5
Name: phosphoglucomutase 5
Synonyms: 9530034F03Rik, aciculin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226041
HGNC: HGNC:8908
Homologene: 74881
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Plcz1
Name: phospholipase C, zeta 1
Synonyms: 1700041H07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114875
Homologene: 23815
Abcg4
Name: ATP binding cassette subfamily G member 4
Synonyms: 6430517O04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 192663
Homologene: 75179
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Gas6
Name: growth arrest specific 6
Synonyms: growth arrest-specific, GAS 6, Gas-6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14456
HGNC: HGNC:4168
Homologene: 638
Pcdh10
Name: protocadherin 10
Synonyms: 6430703F07Rik, 6430521D13Rik, OL-pc, Olpc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18526
Homologene: 74967
Sclt1
Name: sodium channel and clathrin linker 1
Synonyms: 4931421F20Rik, 2610207F23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67161
Homologene: 27031
Wdpcp
Name: WD repeat containing planar cell polarity effector
Synonyms: homoloc-13, AV249152
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216560
Homologene: 9299
Kif6
Name: kinesin family member 6
Synonyms: D130004B10Rik, D130084M03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319991
Homologene: 35308
Rab11fip1
Name: RAB11 family interacting protein 1 (class I)
Synonyms: 2010200K21Rik, 4833414G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75767
Homologene: 11853
Or10j7
Name: olfactory receptor family 10 subfamily J member 7
Synonyms: GA_x6K02T2R7CC-664297-665229, MOR267-5, Olfr1406
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258758
Homologene: 133644
Slc30a4
Name: solute carrier family 30 (zinc transporter), member 4
Synonyms: Znt4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22785
Homologene: 74984
Ifitm6
Name: interferon induced transmembrane protein 6
Synonyms: fragilis5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 213002
HGNC: HGNC:5414
Homologene: 72556
Slco1c1
Name: solute carrier organic anion transporter family, member 1c1
Synonyms: OATP-F, Slc21a14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58807
Homologene: 23008
Pkn1
Name: protein kinase N1
Synonyms: Pkn, PRK1, PAK1, Stk3, Prkcl1, F730027O18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320795
HGNC: HGNC:9405
Homologene: 48130
Rilp
Name: Rab interacting lysosomal protein
Synonyms: LOC333615
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 280408
Homologene: 19596
Iqce
Name: IQ motif containing E
Synonyms: 1700028P05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74239
Homologene: 49912
Zfp955b
Name: zinc finger protein 955B
Synonyms: C430039G02Rik, A430003O12Rik, Gm4455
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100043468
VEGA: 17
Homologene: 104925
Vmn1r70
Name: vomeronasal 1 receptor 70
Synonyms: V1rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171262
Homologene: 74361
Tmed5
Name: transmembrane p24 trafficking protein 5
Synonyms: 3110020O18Rik, 4432412D15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73130
Homologene: 4996
Or5b12b
Name: olfactory receptor family 5 subfamily B member 12B
Synonyms: GA_x6K02T2RE5P-3213352-3214296, MOR202-7, Olfr1445
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258694
Homologene: 133606
Igsf5
Name: immunoglobulin superfamily, member 5
Synonyms: 2010003D20Rik, Igsf5, Jam4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72058
HGNC: HGNC:5952
Homologene: 12437
Ch25h
Name: cholesterol 25-hydroxylase
Synonyms: m25OH
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12642
VEGA: 19
HGNC: HGNC:1907
Homologene: 2942
Cbx2
Name: chromobox 2
Synonyms: M33
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12416
HGNC: HGNC:1552
Homologene: 7256
Kyat3
Name: kynurenine aminotransferase 3
Synonyms: KATIII, Kat3, Ccbl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229905
Homologene: 2994
Dcstamp
Name: dendrocyte expressed seven transmembrane protein
Synonyms: 4833414I07Rik, DC-STAMP, Tm7sf4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75766
VEGA: 15
Homologene: 12769
Cyp4a30b
Name: cytochrome P450, family 4, subfamily a, polypeptide 30b
Synonyms: OTTMUSG00000008626, Cyp4a30b-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435802
Hnrnpa1l2-ps2
Name: heterogeneous nuclear ribonucleoprotein A1-like 2, pseudogene 2
Synonyms: Gm5803
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545091
Homologene: 134075
Sys1
Name: SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Synonyms: 2610042O14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66460
Homologene: 43135
Gm9939
Name: predicted gene 9939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 8,414,271 bp
  • T to C, chromosome 1 at 14,898,268 bp
  • T to C, chromosome 1 at 173,184,018 bp
  • T to C, chromosome 1 at 188,797,827 bp
  • T to C, chromosome 2 at 58,459,017 bp
  • T to A, chromosome 2 at 76,725,051 bp
  • A to G, chromosome 2 at 122,686,983 bp
  • G to A, chromosome 2 at 127,602,435 bp
  • A to G, chromosome 2 at 156,273,798 bp
  • G to T, chromosome 2 at 164,464,509 bp
  • A to G, chromosome 3 at 41,661,590 bp
  • A to G, chromosome 3 at 45,384,168 bp
  • A to C, chromosome 3 at 88,693,096 bp
  • T to C, chromosome 3 at 142,744,143 bp
  • C to T, chromosome 4 at 46,629,912 bp
  • C to A, chromosome 4 at 110,206,603 bp
  • C to A, chromosome 4 at 115,458,866 bp
  • T to C, chromosome 4 at 132,378,455 bp
  • A to G, chromosome 5 at 45,504,751 bp
  • A to G, chromosome 5 at 108,124,596 bp
  • A to G, chromosome 5 at 140,671,805 bp
  • T to C, chromosome 6 at 55,065,607 bp
  • C to T, chromosome 6 at 85,641,329 bp
  • ACAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGC, chromosome 6 at 125,036,509 bp
  • T to A, chromosome 6 at 140,039,755 bp
  • C to T, chromosome 6 at 141,567,496 bp
  • A to T, chromosome 7 at 10,634,475 bp
  • G to A, chromosome 7 at 49,927,573 bp
  • T to C, chromosome 7 at 55,892,001 bp
  • T to A, chromosome 7 at 139,984,867 bp
  • T to C, chromosome 7 at 141,016,072 bp
  • C to T, chromosome 8 at 13,466,764 bp
  • T to A, chromosome 8 at 27,151,975 bp
  • T to C, chromosome 8 at 34,965,665 bp
  • C to T, chromosome 8 at 83,684,722 bp
  • G to T, chromosome 8 at 122,386,920 bp
  • T to C, chromosome 9 at 44,281,408 bp
  • A to T, chromosome 9 at 83,401,743 bp
  • C to G, chromosome 10 at 88,751,467 bp
  • T to C, chromosome 10 at 127,444,402 bp
  • G to A, chromosome 11 at 21,711,732 bp
  • A to G, chromosome 11 at 75,178,838 bp
  • A to G, chromosome 11 at 75,511,425 bp
  • C to G, chromosome 11 at 84,910,448 bp
  • A to T, chromosome 11 at 107,981,647 bp
  • A to G, chromosome 11 at 119,028,949 bp
  • C to A, chromosome 13 at 23,581,796 bp
  • A to G, chromosome 13 at 59,482,580 bp
  • A to G, chromosome 13 at 81,528,816 bp
  • A to C, chromosome 13 at 97,961,460 bp
  • T to C, chromosome 15 at 22,714,280 bp
  • A to G, chromosome 15 at 39,759,540 bp
  • A to T, chromosome 15 at 73,304,445 bp
  • C to T, chromosome 16 at 49,069,537 bp
  • T to A, chromosome 16 at 96,386,531 bp
  • C to T, chromosome 17 at 33,302,187 bp
  • T to C, chromosome 17 at 49,615,191 bp
  • T to C, chromosome 18 at 5,767,227 bp
  • T to G, chromosome 18 at 59,176,397 bp
  • T to C, chromosome 19 at 12,884,387 bp
  • T to C, chromosome 19 at 22,978,573 bp
  • A to T, chromosome 19 at 24,824,451 bp
  • A to G, chromosome 19 at 34,474,463 bp
  • C to A, chromosome 19 at 34,951,549 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5558 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043115-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.