Strain Name:
C57BL/6J-MtgxR5626Btlr/Mmmh
Stock Number:
043165-MU
Citation ID:
RRID:MMRRC_043165-MU
Other Names:
R5626 (G1), C57BL/6J-MtgxR5626Btlr
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETb, Sox10m1, ETR-b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Ppp5c
Name: protein phosphatase 5, catalytic subunit
Synonyms: ANP receptor, PP5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19060
HGNC: HGNC:9322
Homologene: 4550
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 52850
Homologene: 64485
Hira
Name: histone cell cycle regulator
Synonyms: Tuple1, D16Ertd95e, Gm15797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 15260
HGNC: HGNC:4916
Homologene: 48172
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74383
Homologene: 136291
Carhsp1
Name: calcium regulated heat stable protein 1
Synonyms: 1200011K09Rik, D16Ertd465e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 52502
VEGA: 16
Homologene: 8632
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Ncbp1
Name: nuclear cap binding protein subunit 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433702
HGNC: HGNC:7658
Homologene: 1859
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Rbm26
Name: RNA binding motif protein 26
Synonyms: Pro1777, C230097K14Rik, 1700009P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74213
Homologene: 41468
Gpc1
Name: glypican 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14733
HGNC: HGNC:4449
Homologene: 20477
Wnt3a
Name: wingless-type MMTV integration site family, member 3A
Synonyms: Wnt-3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22416
Homologene: 22528
Cpxm2
Name: carboxypeptidase X, M14 family member 2
Synonyms: 4632435C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 55987
Homologene: 69259
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 383435
Homologene: 138453
Zfp998
Name: zinc finger protein 998
Synonyms: Gt(pU21)35Imeg, Gt(Ayu21)35Imeg, 2410141K09Rik, Snerv1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76803
Homologene: 136362
Myof
Name: myoferlin
Synonyms: 2310051D19Rik, E030042N20Rik, Fer1l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226101
VEGA: 19
HGNC: HGNC:3656
Homologene: 40882
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
F5
Name: coagulation factor V
Synonyms: Cf5, Cf-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Trp53i11
Name: transformation related protein 53 inducible protein 11
Synonyms: Tp53i11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 277414
Homologene: 4404
Plcb3
Name: phospholipase C, beta 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18797
VEGA: 19
HGNC: HGNC:9056
Homologene: 47960
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268780
Homologene: 65044
Pitpnm3
Name: PITPNM family member 3
Synonyms: A330068P14Rik, Ackr6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327958
Homologene: 66271
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Cfap57
Name: cilia and flagella associated protein 57
Synonyms: C130004B06Rik, LOC384050, 1110020C03Rik, Wdr65
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68625
Homologene: 51350
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clc4-2, Clcn4-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
C9
Name: complement component 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12279
HGNC: HGNC:1358
Homologene: 74406
Qrsl1
Name: glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Synonyms: GatA, 2700038P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76563
Homologene: 6699
Lcmt2
Name: leucine carboxyl methyltransferase 2
Synonyms: Tyw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329504
Homologene: 19642
Slc22a16
Name: solute carrier family 22 (organic cation transporter), member 16
Synonyms: FLIPT2, OKB1, OCT6, CT2, 4921504E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70840
Homologene: 41957
Calhm2
Name: calcium homeostasis modulator family member 2
Synonyms: 2810048G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72691
Homologene: 9303
Adh1
Name: alcohol dehydrogenase 1 (class I)
Synonyms: ADH-AA, class I alcohol dehydrogenase, Adh-1-t, Adh-1t, Adh-1, Adh1-t, Adh1-e, Adh1tl, Adh-1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11522
Homologene: 73888
Ddi1
Name: DNA-damage inducible 1
Synonyms: 1700011N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71829
VEGA: 9
Homologene: 100549
Saxo1
Name: stabilizer of axonemal microtubules 1
Synonyms: 4930500O09Rik, Fam154a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75811
Homologene: 27548
Tmem30c
Name: transmembrane protein 30C
Synonyms: 4933409A18Rik, 4933401B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 71027
Homologene: 78138
Crisp4
Name: cysteine-rich secretory protein 4
Synonyms: 9230112K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 78081
HGNC: HGNC:304
Homologene: 81683
Gm16387
Name: predicted gene 16387
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100038914
Ighv16-1
Name: immunoglobulin heavy variable 16-1
Synonyms: Gm7005
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 629812
Gm11449
Name: predicted gene 11449
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108168835
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 18,130,121 bp
  • T to A, chromosome 1 at 92,857,119 bp
  • C to T, chromosome 1 at 150,656,567 bp
  • A to G, chromosome 1 at 164,209,035 bp
  • A to G, chromosome 2 at 93,199,378 bp
  • T to C, chromosome 2 at 121,139,462 bp
  • A to T, chromosome 2 at 161,482,869 bp
  • A to T, chromosome 3 at 90,038,512 bp
  • G to C, chromosome 3 at 138,280,410 bp
  • G to A, chromosome 4 at 46,161,290 bp
  • T to C, chromosome 4 at 86,445,589 bp
  • A to G, chromosome 4 at 118,614,783 bp
  • G to A, chromosome 5 at 113,280,415 bp
  • T to C, chromosome 6 at 64,076,945 bp
  • A to T, chromosome 7 at 7,289,018 bp
  • T to C, chromosome 7 at 17,027,704 bp
  • T to C, chromosome 7 at 39,262,061 bp
  • TGCAGCAGCAGCAGCAGCAG to TGCAGCAGCAGCAGCAG, chromosome 7 at 132,059,852 bp
  • T to C, chromosome 9 at 6,266,003 bp
  • A to T, chromosome 10 at 40,584,853 bp
  • A to T, chromosome 10 at 43,881,520 bp
  • A to T, chromosome 11 at 59,290,583 bp
  • T to C, chromosome 11 at 72,112,332 bp
  • T to C, chromosome 11 at 108,057,815 bp
  • A to C, chromosome 12 at 78,683,897 bp
  • A to G, chromosome 12 at 110,641,141 bp
  • G to A, chromosome 12 at 114,068,852 bp
  • A to G, chromosome 13 at 66,431,981 bp
  • T to A, chromosome 14 at 103,843,128 bp
  • T to C, chromosome 14 at 105,144,231 bp
  • A to C, chromosome 15 at 6,491,401 bp
  • A to G, chromosome 15 at 7,251,207 bp
  • T to C, chromosome 16 at 8,661,033 bp
  • G to T, chromosome 16 at 18,927,512 bp
  • T to C, chromosome 16 at 57,276,143 bp
  • T to C, chromosome 19 at 6,955,275 bp
  • A to G, chromosome 19 at 11,304,055 bp
  • T to C, chromosome 19 at 37,922,990 bp
  • A to C, chromosome 19 at 47,133,119 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5626 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043165-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.