Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5731Btlr/Mmmh
Stock Number:
043192-MU
Citation ID:
RRID:MMRRC_043192-MU
Other Names:
R5731 (G1), C57BL/6J-MtgxR5731Btlr
Major Collection:

Strain Information

Neurog1
Name: neurogenin 1
Synonyms: neurogenin, Math4C, ngn1, neurogenin 1, Neurod3, bHLHa6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Fkbp15
Name: FK506 binding protein 15
Synonyms: FKBP133, C430014M02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338355
Homologene: 28743
Fip1l1
Name: factor interacting with PAPOLA and CPSF1
Synonyms: Rje, 1300019H17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66899
Homologene: 136254
Psmb7
Name: proteasome (prosome, macropain) subunit, beta type 7
Synonyms: MC14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19177
HGNC: HGNC:9544
Homologene: 2093
Pou4f1
Name: POU domain, class 4, transcription factor 1
Synonyms: Brn-3, Brn3, Brn3a, Brn-3.0, E130119J07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18996
HGNC: HGNC:9218
Homologene: 21255
C1qtnf6
Name: C1q and tumor necrosis factor related protein 6
Synonyms: 2810036M19Rik, CTRP6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72709
Homologene: 12481
Dag1
Name: dystroglycan 1
Synonyms: dystrophin associated glycoprotein 1, DG, D9Wsu13e, alpha-dystroglycan, beta-dystroglycan
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13138
HGNC: HGNC:2666
Homologene: 3234
Hnrnpu
Name: heterogeneous nuclear ribonucleoprotein U
Synonyms: scaffold attachment factor A, Sp120, Hnrpu
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51810
HGNC: HGNC:5048
Homologene: 22991
Fmnl2
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71409
Homologene: 70871
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Tlr3
Name: toll-like receptor 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142980
Homologene: 20696
Tm4sf20
Name: transmembrane 4 L six family member 20
Synonyms: 1810018L02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66261
Homologene: 11722
Prlr
Name: prolactin receptor
Synonyms: Pr-1, Prlr-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19116
HGNC: HGNC:9446
Homologene: 733
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Fam184b
Name: family with sequence similarity 184, member B
Synonyms: 9630031F12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 58227
Homologene: 137353
Clcn3
Name: chloride channel, voltage-sensitive 3
Synonyms: Clc3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12725
HGNC: HGNC:2021
Homologene: 20435
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: vascular endothelial growth factor receptor-1, VEGFR-1, VEGFR1, Flt-1, sFlt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Arl9
Name: ADP-ribosylation factor-like 9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384185
Homologene: 66207
Hacd2
Name: 3-hydroxyacyl-CoA dehydratase 2
Synonyms: 6330408J20Rik, Ptplb
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70757
VEGA: 16
HGNC: HGNC:9640
Homologene: 23409
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
Bpifb9a
Name: BPI fold containing family B, member 9A
Synonyms: vomeromodulin, 4833413D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71425
Homologene: 128535
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Or5d16
Name: olfactory receptor family 5 subfamily D member 16
Synonyms: GA_x6K02T2Q125-49426894-49425950, MOR174-10, Olfr1155
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258636
Homologene: 133739
Osbpl3
Name: oxysterol binding protein-like 3
Synonyms: OSBP3, ORP3, 1200014M06Rik, 6720421I08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71720
Homologene: 49422
Pdlim3
Name: PDZ and LIM domain 3
Synonyms: ALP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 53318
Homologene: 75063
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
C9
Name: complement component 9
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12279
HGNC: HGNC:1358
Homologene: 74406
5930422O12Rik
Name: RIKEN cDNA 5930422O12 gene
Type: Gene
Species: Mouse
Chromosome: 8
Vmn2r28
Name: vomeronasal 2, receptor 28
Synonyms: EG665255, V2r28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665255
Homologene: 129605
Zfyve16
Name: zinc finger, FYVE domain containing 16
Synonyms: B130024H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218441
Homologene: 8826
Ccdc62
Name: coiled-coil domain containing 62
Synonyms: LOC208908, G1-485-3, repro29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208908
Homologene: 82466
Ugt2b5
Name: UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms: Udpgt-3, m-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22238
Homologene: 137225
Acsm2
Name: acyl-CoA synthetase medium-chain family member 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233799
Homologene: 70404
Or11h6
Name: olfactory receptor family 11 subfamily H member 6
Synonyms: GA_x6K02T2PMLR-6361495-6362481, MOR106-11, Olfr745
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258296
Homologene: 27116
Cd177
Name: CD177 antigen
Synonyms: Pdp3, 1190003K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68891
Homologene: 49628
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Gprin2
Name: G protein regulated inducer of neurite outgrowth 2
Synonyms: C130040D06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432839
VEGA: 14
Homologene: 40975
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Pcdha5
Name: protocadherin alpha 5
Synonyms: Cnr6, Crnr6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12941
HGNC: HGNC:8671
Homologene: 49565
Gm10313
Name: predicted pseudogene 10313
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100039875
Gm16062
Name: predicted gene 16062
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100504104
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 82,760,292 bp
  • A to G, chromosome 1 at 178,325,262 bp
  • T to C, chromosome 2 at 38,588,277 bp
  • T to A, chromosome 2 at 53,118,137 bp
  • T to A, chromosome 2 at 87,943,427 bp
  • T to A, chromosome 2 at 112,641,572 bp
  • A to T, chromosome 2 at 154,262,243 bp
  • G to T, chromosome 3 at 122,132,593 bp
  • G to C, chromosome 4 at 62,306,929 bp
  • A to T, chromosome 4 at 149,247,904 bp
  • C to T, chromosome 5 at 45,553,129 bp
  • C to T, chromosome 5 at 74,588,104 bp
  • T to C, chromosome 5 at 77,006,527 bp
  • T to A, chromosome 5 at 87,140,252 bp
  • T to C, chromosome 5 at 114,060,063 bp
  • T to C, chromosome 5 at 123,951,289 bp
  • C to T, chromosome 5 at 124,817,701 bp
  • T to C, chromosome 5 at 147,678,152 bp
  • T to C, chromosome 6 at 50,370,289 bp
  • G to T, chromosome 7 at 5,488,669 bp
  • A to G, chromosome 7 at 24,744,421 bp
  • G to A, chromosome 7 at 119,588,927 bp
  • A to G, chromosome 7 at 128,198,554 bp
  • A to G, chromosome 8 at 33,429,325 bp
  • A to G, chromosome 8 at 45,398,120 bp
  • A to G, chromosome 8 at 45,915,247 bp
  • C to T, chromosome 8 at 46,255,393 bp
  • T to C, chromosome 8 at 60,922,889 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 67,895,379 bp
  • T to C, chromosome 9 at 82,890,340 bp
  • T to C, chromosome 9 at 108,218,111 bp
  • T to C, chromosome 10 at 107,881,464 bp
  • A to G, chromosome 11 at 48,894,448 bp
  • G to A, chromosome 11 at 59,818,369 bp
  • A to T, chromosome 11 at 100,463,763 bp
  • T to C, chromosome 13 at 56,251,541 bp
  • T to A, chromosome 13 at 92,508,193 bp
  • A to G, chromosome 14 at 26,963,656 bp
  • C to A, chromosome 14 at 34,195,440 bp
  • T to C, chromosome 14 at 50,642,791 bp
  • T to C, chromosome 14 at 104,465,911 bp
  • A to G, chromosome 15 at 6,489,877 bp
  • A to G, chromosome 15 at 10,314,135 bp
  • A to T, chromosome 15 at 78,527,314 bp
  • T to A, chromosome 16 at 35,102,004 bp
  • G to A, chromosome 18 at 36,960,767 bp
  • A to C, chromosome 18 at 38,198,598 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5731 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043192-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.