Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5731Btlr/Mmmh
Stock Number:
043192-MU
Citation ID:
RRID:MMRRC_043192-MU
Other Names:
R5731 (G1), C57BL/6J-MtgxR5731Btlr
Major Collection:

Strain Information

Neurog1
Name: neurogenin 1
Synonyms: neurogenin, Math4C, ngn1, neurogenin 1, Neurod3, bHLHa6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Fkbp15
Name: FK506 binding protein 15
Synonyms: FKBP133, C430014M02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338355
Homologene: 28743
Fip1l1
Name: factor interacting with PAPOLA and CPSF1
Synonyms: Rje, 1300019H17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66899
Homologene: 136254
Psmb7
Name: proteasome (prosome, macropain) subunit, beta type 7
Synonyms: MC14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19177
HGNC: HGNC:9544
Homologene: 2093
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 82,760,292 bp
  • A to G, chromosome 1 at 178,325,262 bp
  • T to C, chromosome 2 at 38,588,277 bp
  • T to A, chromosome 2 at 53,118,137 bp
  • T to A, chromosome 2 at 87,943,427 bp
  • T to A, chromosome 2 at 112,641,572 bp
  • A to T, chromosome 2 at 154,262,243 bp
  • G to T, chromosome 3 at 122,132,593 bp
  • G to C, chromosome 4 at 62,306,929 bp
  • A to T, chromosome 4 at 149,247,904 bp
  • C to T, chromosome 5 at 45,553,129 bp
  • C to T, chromosome 5 at 74,588,104 bp
  • T to C, chromosome 5 at 77,006,527 bp
  • T to A, chromosome 5 at 87,140,252 bp
  • T to C, chromosome 5 at 114,060,063 bp
  • T to C, chromosome 5 at 123,951,289 bp
  • C to T, chromosome 5 at 124,817,701 bp
  • T to C, chromosome 5 at 147,678,152 bp
  • T to C, chromosome 6 at 50,370,289 bp
  • G to T, chromosome 7 at 5,488,669 bp
  • A to G, chromosome 7 at 24,744,421 bp
  • G to A, chromosome 7 at 119,588,927 bp
  • A to G, chromosome 7 at 128,198,554 bp
  • A to G, chromosome 8 at 33,429,325 bp
  • A to G, chromosome 8 at 45,398,120 bp
  • A to G, chromosome 8 at 45,915,247 bp
  • C to T, chromosome 8 at 46,255,393 bp
  • T to C, chromosome 8 at 60,922,889 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 67,895,379 bp
  • T to C, chromosome 9 at 82,890,340 bp
  • T to C, chromosome 9 at 108,218,111 bp
  • T to C, chromosome 10 at 107,881,464 bp
  • A to G, chromosome 11 at 48,894,448 bp
  • G to A, chromosome 11 at 59,818,369 bp
  • A to T, chromosome 11 at 100,463,763 bp
  • T to C, chromosome 13 at 56,251,541 bp
  • T to A, chromosome 13 at 92,508,193 bp
  • A to G, chromosome 14 at 26,963,656 bp
  • C to A, chromosome 14 at 34,195,440 bp
  • T to C, chromosome 14 at 50,642,791 bp
  • T to C, chromosome 14 at 104,465,911 bp
  • A to G, chromosome 15 at 6,489,877 bp
  • A to G, chromosome 15 at 10,314,135 bp
  • A to T, chromosome 15 at 78,527,314 bp
  • T to A, chromosome 16 at 35,102,004 bp
  • G to A, chromosome 18 at 36,960,767 bp
  • A to C, chromosome 18 at 38,198,598 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5731 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043192-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.