Strain Name:
C57BL/6J-MtgxR5816Btlr/Mmmh
Stock Number:
043214-MU
Citation ID:
RRID:MMRRC_043214-MU
Other Names:
R5816 (G1), C57BL/6J-MtgxR5816Btlr
Major Collection:

Gene Information

Glrb
Name: glycine receptor, beta subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14658
HGNC: HGNC:4329
Homologene: 20224
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 60611
Homologene: 10187
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20588
Homologene: 68296
Mllt6
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms: Af17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 246198
HGNC: HGNC:7138
Homologene: 31347
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74203
Homologene: 10522
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Kdm3b
Name: KDM3B lysine (K)-specific demethylase 3B
Synonyms: 5830462I21Rik, JHDM2B, Jmjd1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 277250
VEGA: 18
HGNC: HGNC:1337
Homologene: 41145
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71685
Homologene: 56997
Pfkl
Name: phosphofructokinase, liver, B-type
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18641
HGNC: HGNC:8876
Homologene: 55668
Eif5a
Name: eukaryotic translation initiation factor 5A
Synonyms: D19Wsu54e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276770
HGNC: HGNC:3300
Homologene: 133803
Mcm6
Name: minichromosome maintenance complex component 6
Synonyms: Mcmd6, D1Wsu22e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17219
HGNC: HGNC:6949
Homologene: 4322
Cep72
Name: centrosomal protein 72
Synonyms: 2610029E11Rik, 4933440J22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74470
VEGA: 13
Homologene: 10027
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Olfr965
Name: olfactory receptor 965
Synonyms: GA_x6K02T2PVTD-33416730-33417668, MOR171-28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258165
VEGA: 9
Cyp1a2
Name: cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms: P450-3, CP12, aromatic compound inducible
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13077
VEGA: 9
HGNC: HGNC:2596
Homologene: 68082
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74407
Homologene: 12860
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234353
Homologene: 87257
Grb14
Name: growth factor receptor bound protein 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 50915
HGNC: HGNC:4565
Homologene: 3303
Metrnl
Name: meteorin, glial cell differentiation regulator-like
Synonyms: 9430048M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 210029
Homologene: 16993
Acpp
Name: acid phosphatase, prostate
Synonyms: PAP, A030005E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56318
HGNC: HGNC:125
Homologene: 55552
Thbs2
Name: thrombospondin 2
Synonyms: TSP2, Thbs-2, Thrombospondin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21826
VEGA: 17
Homologene: 2438
Matn3
Name: matrilin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 17182
HGNC: HGNC:6909
Homologene: 1785
Prmt8
Name: protein arginine N-methyltransferase 8
Synonyms: Hrmt1l3, Hrmt1l4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381813
HGNC: HGNC:5188
Homologene: 76124
Kcng1
Name: potassium voltage-gated channel, subfamily G, member 1
Synonyms: OTTMUSG00000016048
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241794
HGNC: HGNC:6248
Homologene: 20515
A530053G22Rik
Name: RIKEN cDNA A530053G22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 208079
Aldh8a1
Name: aldehyde dehydrogenase 8 family, member A1
Synonyms: RALDH4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237320
Homologene: 23369
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320772
Homologene: 45659
Slc26a4
Name: solute carrier family 26, member 4
Synonyms: Pds, pendrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 23985
VEGA: 12
HGNC: HGNC:8818
Homologene: 20132
Zbtb6
Name: zinc finger and BTB domain containing 6
Synonyms: A830092L04Rik, Zfp482
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241322
Homologene: 4829
Abcc3
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Synonyms: 1700019L09Rik, MRP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Zfp536
Name: zinc finger protein 536
Synonyms: 9630010P11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243937
Homologene: 8813
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2510025K24Rik, 2810422M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66573
VEGA: 14
Homologene: 45708
Ces1b
Name: carboxylesterase 1B
Synonyms: Gm5158
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382044
HGNC: HGNC:1863
Homologene: 117484
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 668101
Homologene: 82993
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Olfr599
Name: olfactory receptor 599
Synonyms: GA_x6K02T2PBJ9-6047402-6048349, MOR23-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258726
Homologene: 27244
Med11
Name: mediator complex subunit 11
Synonyms: 1110030J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66172
Homologene: 32630
Bend7
Name: BEN domain containing 7
Synonyms: 1110017O21Rik, E130319B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 209645
Homologene: 17660
S100a14
Name: S100 calcium binding protein A14
Synonyms: 1110013O05Rik, S100a15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66166
Homologene: 10781
Phactr3
Name: phosphatase and actin regulator 3
Synonyms: scapinin, 1500003N10Rik, 4930415A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74189
Homologene: 14482
Epn3
Name: epsin 3
Synonyms: 2310022G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71889
Homologene: 56791
Cer1
Name: cerberus 1, DAN family BMP antagonist
Synonyms: Cerberus-like, Cerr1, cer-1, Cerl, Cerl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12622
HGNC: HGNC:1862
Homologene: 3983
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,058,678 bp
  • C to T, chromosome 1 at 34,179,234 bp
  • A to G, chromosome 1 at 128,348,455 bp
  • G to A, chromosome 2 at 4,744,332 bp
  • A to G, chromosome 2 at 4,752,899 bp
  • A to T, chromosome 2 at 37,429,215 bp
  • A to T, chromosome 2 at 64,917,284 bp
  • C to T, chromosome 2 at 168,268,723 bp
  • A to G, chromosome 2 at 178,302,793 bp
  • T to C, chromosome 3 at 15,548,757 bp
  • T to A, chromosome 3 at 80,861,979 bp
  • A to G, chromosome 3 at 90,527,850 bp
  • A to G, chromosome 4 at 82,882,883 bp
  • A to T, chromosome 6 at 60,402,134 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,965 bp
  • G to A, chromosome 6 at 122,833,736 bp
  • G to A, chromosome 6 at 127,697,738 bp
  • C to T, chromosome 7 at 37,480,628 bp
  • A to G, chromosome 7 at 103,338,995 bp
  • T to C, chromosome 8 at 22,096,736 bp
  • A to T, chromosome 8 at 67,960,510 bp
  • T to C, chromosome 8 at 93,073,262 bp
  • T to A, chromosome 9 at 39,719,230 bp
  • T to C, chromosome 9 at 57,681,053 bp
  • T to A, chromosome 9 at 104,319,980 bp
  • T to C, chromosome 9 at 110,197,644 bp
  • A to T, chromosome 10 at 21,395,430 bp
  • A to T, chromosome 10 at 78,002,022 bp
  • T to C, chromosome 11 at 3,242,401 bp
  • C to T, chromosome 11 at 69,917,673 bp
  • T to C, chromosome 11 at 70,452,285 bp
  • T to C, chromosome 11 at 94,343,737 bp
  • A to G, chromosome 11 at 94,492,305 bp
  • A to G, chromosome 11 at 97,672,574 bp
  • C to T, chromosome 11 at 100,566,979 bp
  • T to A, chromosome 11 at 121,708,112 bp
  • G to A, chromosome 12 at 8,970,571 bp
  • G to T, chromosome 12 at 31,528,685 bp
  • T to C, chromosome 12 at 66,655,182 bp
  • A to T, chromosome 13 at 46,713,742 bp
  • A to T, chromosome 13 at 74,049,031 bp
  • G to A, chromosome 14 at 118,909,480 bp
  • A to G, chromosome 15 at 44,566,322 bp
  • T to A, chromosome 17 at 3,177,713 bp
  • C to T, chromosome 17 at 14,684,071 bp
  • T to C, chromosome 17 at 73,574,882 bp
  • A to C, chromosome 18 at 34,828,469 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5816 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043214-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.