Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5816Btlr/Mmmh
Stock Number:
043214-MU
Citation ID:
RRID:MMRRC_043214-MU
Other Names:
R5816 (G1), C57BL/6J-MtgxR5816Btlr
Major Collection:

Strain Information

Glrb
Name: glycine receptor, beta subunit
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14658
HGNC: HGNC:4329
Homologene: 20224
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60611
Homologene: 10187
Smarcc1
Name: SWI/SNF related BAF chromatin remodeling complex subunit C1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Mllt6
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms: Af17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246198
HGNC: HGNC:7138
Homologene: 31347
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Kdm3b
Name: KDM3B lysine (K)-specific demethylase 3B
Synonyms: 5830462I21Rik, JHDM2B, Jmjd1b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 277250
VEGA: 18
HGNC: HGNC:1337
Homologene: 41145
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71685
Homologene: 56997
Pfkl
Name: phosphofructokinase, liver, B-type
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18641
HGNC: HGNC:8876
Homologene: 55668
Eif5a
Name: eukaryotic translation initiation factor 5A
Synonyms: D19Wsu54e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276770
Homologene: 133803
Mcm6
Name: minichromosome maintenance complex component 6
Synonyms: Mcmd6, D1Wsu22e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17219
HGNC: HGNC:6949
Homologene: 4322
Cep72
Name: centrosomal protein 72
Synonyms: 2610029E11Rik, 4933440J22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74470
VEGA: 13
Homologene: 10027
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Or8g52
Name: olfactory receptor family 8 subfamily G member 52
Synonyms: GA_x6K02T2PVTD-33416730-33417668, MOR171-28, Olfr965
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258165
VEGA: 9
Cyp1a2
Name: cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms: P450-3, CP12, aromatic compound inducible
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13077
VEGA: 9
HGNC: HGNC:2596
Homologene: 68082
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74407
Homologene: 12860
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Grb14
Name: growth factor receptor bound protein 14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50915
HGNC: HGNC:4565
Homologene: 3303
Metrnl
Name: meteorin, glial cell differentiation regulator-like
Synonyms: 9430048M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210029
Homologene: 16993
Acp3
Name: acid phosphatase 3
Synonyms: PAP, A030005E02Rik, Acpp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56318
HGNC: HGNC:125
Homologene: 55552
Thbs2
Name: thrombospondin 2
Synonyms: TSP2, Thbs-2, Thrombospondin-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21826
VEGA: 17
Homologene: 2438
Prmt8
Name: protein arginine N-methyltransferase 8
Synonyms: Hrmt1l3, Hrmt1l4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381813
HGNC: HGNC:5188
Homologene: 76124
Kcng1
Name: potassium voltage-gated channel, subfamily G, member 1
Synonyms: OTTMUSG00000016048
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241794
HGNC: HGNC:6248
Homologene: 20515
A530053G22Rik
Name: RIKEN cDNA A530053G22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 208079
Aldh8a1
Name: aldehyde dehydrogenase 8 family, member A1
Synonyms: RALDH4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237320
Homologene: 23369
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Slc26a4
Name: solute carrier family 26, member 4
Synonyms: Pds, pendrin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23985
VEGA: 12
HGNC: HGNC:8818
Homologene: 20132
Zbtb6
Name: zinc finger and BTB domain containing 6
Synonyms: A830092L04Rik, Zfp482
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241322
Homologene: 4829
Abcc3
Name: ATP-binding cassette, sub-family C member 3
Synonyms: 1700019L09Rik, MRP3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Zfp536
Name: zinc finger protein 536
Synonyms: 9630010P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243937
Homologene: 8813
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2510025K24Rik, 2810422M04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66573
VEGA: 14
Homologene: 45708
Ces1b
Name: carboxylesterase 1B
Synonyms: Gm5158
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382044
Homologene: 117484
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668101
Homologene: 82993
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Or52ab4
Name: olfactory receptor family 52 subfamily AB member 4
Synonyms: GA_x6K02T2PBJ9-6047402-6048349, MOR23-1, Olfr599
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258726
Homologene: 27244
Med11
Name: mediator complex subunit 11
Synonyms: 1110030J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66172
Homologene: 32630
Bend7
Name: BEN domain containing 7
Synonyms: 1110017O21Rik, E130319B15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209645
Homologene: 17660
S100a14
Name: S100 calcium binding protein A14
Synonyms: 1110013O05Rik, S100a15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66166
Homologene: 10781
Phactr3
Name: phosphatase and actin regulator 3
Synonyms: scapinin, 1500003N10Rik, 4930415A02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74189
Homologene: 14482
Epn3
Name: epsin 3
Synonyms: 2310022G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71889
Homologene: 56791
Cer1
Name: cerberus 1, DAN family BMP antagonist
Synonyms: Cerberus-like, Cerr1, cer-1, Cerl, Cerl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12622
HGNC: HGNC:1862
Homologene: 3983
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,058,678 bp
  • C to T, chromosome 1 at 34,179,234 bp
  • A to G, chromosome 1 at 128,348,455 bp
  • G to A, chromosome 2 at 4,744,332 bp
  • A to G, chromosome 2 at 4,752,899 bp
  • A to T, chromosome 2 at 37,429,215 bp
  • A to T, chromosome 2 at 64,917,284 bp
  • C to T, chromosome 2 at 168,268,723 bp
  • A to G, chromosome 2 at 178,302,793 bp
  • T to C, chromosome 3 at 15,548,757 bp
  • T to A, chromosome 3 at 80,861,979 bp
  • A to G, chromosome 3 at 90,527,850 bp
  • A to G, chromosome 4 at 82,882,883 bp
  • A to T, chromosome 6 at 60,402,134 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,965 bp
  • G to A, chromosome 6 at 122,833,736 bp
  • G to A, chromosome 6 at 127,697,738 bp
  • C to T, chromosome 7 at 37,480,628 bp
  • A to G, chromosome 7 at 103,338,995 bp
  • T to C, chromosome 8 at 22,096,736 bp
  • A to T, chromosome 8 at 67,960,510 bp
  • T to C, chromosome 8 at 93,073,262 bp
  • T to A, chromosome 9 at 39,719,230 bp
  • T to C, chromosome 9 at 57,681,053 bp
  • T to A, chromosome 9 at 104,319,980 bp
  • T to C, chromosome 9 at 110,197,644 bp
  • A to T, chromosome 10 at 21,395,430 bp
  • A to T, chromosome 10 at 78,002,022 bp
  • T to C, chromosome 11 at 3,242,401 bp
  • C to T, chromosome 11 at 69,917,673 bp
  • T to C, chromosome 11 at 70,452,285 bp
  • T to C, chromosome 11 at 94,343,737 bp
  • A to G, chromosome 11 at 94,492,305 bp
  • A to G, chromosome 11 at 97,672,574 bp
  • C to T, chromosome 11 at 100,566,979 bp
  • T to A, chromosome 11 at 121,708,112 bp
  • G to A, chromosome 12 at 8,970,571 bp
  • G to T, chromosome 12 at 31,528,685 bp
  • T to C, chromosome 12 at 66,655,182 bp
  • A to T, chromosome 13 at 46,713,742 bp
  • A to T, chromosome 13 at 74,049,031 bp
  • G to A, chromosome 14 at 118,909,480 bp
  • A to G, chromosome 15 at 44,566,322 bp
  • T to A, chromosome 17 at 3,177,713 bp
  • C to T, chromosome 17 at 14,684,071 bp
  • T to C, chromosome 17 at 73,574,882 bp
  • A to C, chromosome 18 at 34,828,469 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5816 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043214-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.