Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5882Btlr/Mmmh
Stock Number:
043236-MU
Citation ID:
RRID:MMRRC_043236-MU
Other Names:
R5882 (G1), C57BL/6J-MtgxR5882Btlr
Major Collection:

Strain Information

Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Mcm7
Name: minichromosome maintenance complex component 7
Synonyms: mCDC47, Mcmd7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17220
HGNC: HGNC:6950
Homologene: 4323
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Nln
Name: neurolysin (metallopeptidase M3 family)
Synonyms: 4930472G13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75805
VEGA: 13
Homologene: 69315
Dcaf4
Name: DDB1 and CUL4 associated factor 4
Synonyms: 1110018E21Rik, Wdr21
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73828
VEGA: 12
Homologene: 9210
Dmbx1
Name: diencephalon/mesencephalon homeobox 1
Synonyms: Cdmx, Atx, Mbx, Dmbx1, Otx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140477
Homologene: 15639
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 209456
Homologene: 3959
Kars1
Name: lysyl-tRNA synthetase 1
Synonyms: D8Wsu108e, LysRS, D8Ertd698e, Kars
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 85305
HGNC: HGNC:6215
Homologene: 4053
St7
Name: suppression of tumorigenicity 7
Synonyms: RAY1, HELG, SEN4, TSG7, Fam4a2, 9430001H04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Prkg1
Name: protein kinase, cGMP-dependent, type I
Synonyms: Prkgr1b, Prkg1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19091
HGNC: HGNC:9414
Homologene: 55964
Ush1g
Name: USH1 protein network component sans
Synonyms: js, Sans
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16470
Homologene: 56113
Scnn1g
Name: sodium channel, nonvoltage-gated 1 gamma
Synonyms: ENaC gamma
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20278
Homologene: 20280
Insc
Name: INSC spindle orientation adaptor protein
Synonyms: Inscuteable, 3830422K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233752
Homologene: 78662
Lrrc74b
Name: leucine rich repeat containing 74B
Synonyms: 4930451C15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74685
Homologene: 25894
Zim1
Name: zinc finger, imprinted 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22776
Homologene: 129793
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: testican 3, 2900045C01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72902
Homologene: 9662
Phactr1
Name: phosphatase and actin regulator 1
Synonyms: Rpel1, 9630030F18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218194
Homologene: 33597
Wdr83
Name: WD repeat domain containing 83
Synonyms: 1500041N16Rik, Morg1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67836
Homologene: 12194
Tdrd1
Name: tudor domain containing 1
Synonyms: MTR-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83561
Homologene: 12850
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Myo15b
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Obox3
Name: oocyte specific homeobox 3
Synonyms: Ohx
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246791
Homologene: 44937
Or4k35
Name: olfactory receptor family 4 subfamily K member 35
Synonyms: GA_x6K02T2Q125-72321818-72320907, MOR248-11, Olfr1277
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258391
Homologene: 105176
Serpina6
Name: serine (or cysteine) peptidase inhibitor, clade A, member 6
Synonyms: Cbg
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12401
HGNC: HGNC:1540
Homologene: 20417
Pcdhb1
Name: protocadherin beta 1
Synonyms: PcdhbA
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93872
HGNC: HGNC:8680
Homologene: 8348
Zfp882
Name: zinc finger protein 882
Synonyms: ENSMUSG00000052439
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382019
Homologene: 136303
Stoml2
Name: stomatin (Epb7.2)-like 2
Synonyms: 0610038F01Rik, SLP-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66592
Homologene: 8389
Nacad
Name: NAC alpha domain containing
Synonyms: mKIAA0363
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192950
Homologene: 135717
Oas1f
Name: 2'-5' oligoadenylate synthetase 1F
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243262
HGNC: HGNC:8086
Homologene: 86720
Or8b12
Name: olfactory receptor family 8 subfamily B member 12
Synonyms: GA_x6K02T2PVTD-31428850-31429782, MOR161-2, Olfr874
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258882
Homologene: 17377
Tmem38a
Name: transmembrane protein 38A
Synonyms: 1110001E17Rik, TRIC-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74166
Homologene: 11449
Apol7e
Name: apolipoprotein L 7e
Synonyms: ENSMUSG00000071716
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666348
VEGA: 15
HGNC: HGNC:619
Homologene: 40940
Nit2
Name: nitrilase family, member 2
Synonyms: 1190017B19Rik, D16Ertd502e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52633
VEGA: 16
Homologene: 6520
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp
  • T to C, chromosome 1 at 182,442,212 bp
  • A to G, chromosome 2 at 37,961,663 bp
  • A to T, chromosome 2 at 111,270,139 bp
  • C to T, chromosome 2 at 142,707,258 bp
  • G to C, chromosome 4 at 43,031,003 bp
  • T to A, chromosome 4 at 96,535,602 bp
  • G to T, chromosome 4 at 115,920,301 bp
  • A to G, chromosome 5 at 32,946,723 bp
  • A to G, chromosome 5 at 110,755,587 bp
  • G to A, chromosome 5 at 120,848,253 bp
  • A to T, chromosome 5 at 138,165,649 bp
  • T to C, chromosome 6 at 17,846,249 bp
  • A to T, chromosome 7 at 6,682,738 bp
  • A to G, chromosome 7 at 15,626,968 bp
  • T to C, chromosome 7 at 114,811,698 bp
  • A to T, chromosome 7 at 121,767,358 bp
  • A to G, chromosome 8 at 63,143,931 bp
  • A to T, chromosome 8 at 71,913,459 bp
  • A to G, chromosome 8 at 72,585,887 bp
  • T to C, chromosome 8 at 85,081,155 bp
  • G to A, chromosome 8 at 112,003,425 bp
  • C to T, chromosome 9 at 37,746,632 bp
  • A to T, chromosome 9 at 57,139,663 bp
  • C to T, chromosome 11 at 6,598,568 bp
  • A to G, chromosome 11 at 22,171,200 bp
  • T to A, chromosome 11 at 94,459,819 bp
  • C to A, chromosome 11 at 115,318,542 bp
  • A to G, chromosome 11 at 115,869,596 bp
  • T to C, chromosome 12 at 83,539,429 bp
  • T to C, chromosome 12 at 103,654,235 bp
  • G to T, chromosome 13 at 42,709,851 bp
  • G to T, chromosome 13 at 104,059,498 bp
  • T to A, chromosome 15 at 77,718,247 bp
  • C to A, chromosome 16 at 17,548,694 bp
  • T to C, chromosome 16 at 57,159,466 bp
  • G to C, chromosome 17 at 71,110,722 bp
  • A to T, chromosome 18 at 37,267,177 bp
  • A to T, chromosome 19 at 31,585,697 bp
  • C to T, chromosome 19 at 56,848,939 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5882 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043236-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.