Strain Name:
FVB/N-AU040320em1Janc/Mmucd
Stock Number:
043535-UCD
Citation ID:
RRID:MMRRC_043535-UCD
Other Names:
AAVR-KO, Au040320 -/-; Kiaa0319l -/-

Strain Information

AU040320em1Janc
Name: expressed sequence AU040320; endonuclease-mediated mutation 1, Jan Carette
Synonyms: Aavr-, Kiaa0319l-
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Targeted Mutation
AU040320
Name: expressed sequence AU040320
Type: Gene
Species: Mouse
Chromosome: 4
Alteration at locus: Targeted Mutation
NCBI: 100317
Homologene: 11764
Genetic Alterations
Single base pair deletion as follows:
  • Gene: Au040320 (Gene ID:100317)
  • Species: Mouse
  • Reference sequence (CDS): NM_001035526.1
  • Nucleic acid level: c.40delT
  • Protein level: p.(Trp14Glyfs*12)

  • KO: tgggagtcaagccaagtcccgcttccXgggttttgccaggatattg 
    WT: tgggagtcaagccaagtcccgcttccTgggttttgccaggatattg
    Genotype Determination
    Phenotype

    Homozygous: No obvious physiological or developmental abnormalities identified. However detailed studies were not done.

    Hetero/Hemizygous: No obvious physiological or developmental abnormalities identified. However detailed studies were not done.

    Cre-excised Phenotype: Undetermined.

    Mammalian Phenotype Terms
    Allelic Composition: (Genetic Background: )

    MeSH Terms
    • Animals
    • Antibodies/immunology
    • Antibodies/pharmacology
    • Cell Line
    • Dependovirus/classification
    • Dependovirus/drug effects
    • Dependovirus/physiology
    • Endocytosis/drug effects
    • Female
    • Gene Deletion
    • Genetic Therapy/methods
    • Host Specificity
    • Humans
    • Male
    • Mice
    • Parvoviridae Infections/metabolism
    • Parvoviridae Infections/virology
    • Receptors, Cell Surface/antagonists & inhibitors
    • Receptors, Cell Surface/deficiency
    • Receptors, Cell Surface/genetics
    • Receptors, Cell Surface/metabolism
    • Receptors, Virus/antagonists & inhibitors
    • Receptors, Virus/deficiency
    • Receptors, Virus/genetics
    • Receptors, Virus/metabolism
    • Viral Tropism/drug effects
    • Virus Internalization/drug effects
    • trans-Golgi Network/drug effects
    Strain Development
    Generated at a contract facility (Cyagen Biosciences, Inc.) using FVB/N embryos.
    Suggested Control Mice
    Wild-type littermates
    MMRRC Genetic QC Summary
    Genetic QC analysis (GQC) was performed on representative samples from the donor submission and provides a baseline reference. Regardless of the material ordered (live mice, sperm, embryos, resuscitated animals), the provided material is guaranteed to contain the primary genetic alteration of interest; however, the composition of the genetic background may vary (See Reproducibility sections of the report for details). The impact of genetic background on previously reported phenotypes has not been evaluated.

    GQC analysis was done on two XY samples, LJ5671 and HI8171, at the time of importation and the conclusions are consistent in all samples. The results of the analysis are congruent with the SDS and LJ5671 is the representative sample selected for the report. The strain background is FVB/N. The mitochondrial genome and Y chromosome are consistent with the FVB/N background and none of the constructs detectable by MiniMUGA are present.

    The genome of the MMRRC:43535 strain is 100 % inbred.
    MiniMUGA Sample Report
    • Research Tools
    • Virology
    Donor
    Jan Carette, Ph.D., Stanford University School of Medicine.
    Primary Reference

    Pillay S, Meyer NL, Puschnik AS, Davulcu O, Diep J, Ishikawa Y, Jae LT, Wosen JE, Nagamine CM, Chapman MS, Carette JE. An essential receptor for adeno-associated virus infection. Nature. 2016 Feb 4;530(7588):108-12. doi: 10.1038/nature16465. Epub 2016 Jan 27. Erratum in: Nature. 2016 Nov 17;539(7629):456. (Medline PMID: 26814968)

    Additional References

    Pillay S, Meyer NL, Puschnik AS, Davulcu O, Diep J, Ishikawa Y, Jae LT, Wosen JE, Nagamine CM, Chapman MS, Carette JE. Corrigendum: An essential receptor for adeno-associated virus infection. Nature. 2016 Nov 17;539(7629):456. doi: 10.1038/nature19835. Epub 2016 Sep 28. Erratum for: Nature. 2016 Feb 4;530(7588):108-12. (Medline PMID: 27680708)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
    The MMRRC at UC Davis performed microbita analysis on feces samples received from the donating investigator while the mice were still at their facility. There is a MMRRC Fecal Microbiota report available for this strain.If you are interested in having the MMRRC at UC Davis perform microbiota analysis once the line is established at your facility please contact mmrrc@ucdavis.edu.
    Coat Color
    white
    Other
    none
    MMRRC Breeding System
    Random intra-strain mating
    Generation
    N/A
    Overall Breeding Performance
    Excellent
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: 6 to 8 months 6 to 8 months
    Bred to Homozygosity
    No
    Average litter size
    5-9
    Recommended wean age
    3 weeks

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    043535-UCD-EMBRYO Cryo-preserved embryos $1,038.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
    043535-UCD-SPERM Cryo-preserved spermatozoa $546.25 / Non-Profit Aliquot Approximate quantity3
    043535-UCD-RESUS Litter recovered from cryo-archive $4,044.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.