Loading Mouse GIF
Loading...

Strain Name:
FVB/N-AU040320em1Janc/Mmucd
Stock Number:
043535-UCD
Citation ID:
RRID:MMRRC_043535-UCD
Other Names:
AAVR-KO, Au040320 -/-; Kiaa0319l -/-

Strain Information

AU040320em1Janc
Name: expressed sequence AU040320; endonuclease-mediated mutation 1, Jan Carette
Synonyms: Aavr-, Kiaa0319l-
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Targeted Mutation
Genetic Alterations
Single base pair deletion as follows:
  • Gene: Au040320 (Gene ID:100317)
  • Species: Mouse
  • Reference sequence (CDS): NM_001035526.1
  • Nucleic acid level: c.40delT
  • Protein level: p.(Trp14Glyfs*12)

  • KO: tgggagtcaagccaagtcccgcttccXgggttttgccaggatattg 
    WT: tgggagtcaagccaagtcccgcttccTgggttttgccaggatattg
    Genotype Determination
    Phenotype

    Homozygous: No obvious physiological or developmental abnormalities identified. However detailed studies were not done.

    Hetero/Hemizygous: No obvious physiological or developmental abnormalities identified. However detailed studies were not done.

    Cre-excised Phenotype: Undetermined.

    Mammalian Phenotype Terms
    Allelic Composition: (Genetic Background: )

    MeSH Terms
    • Animals
    • Antibodies/immunology
    • Antibodies/pharmacology
    • Cell Line
    • Dependovirus/classification
    • Dependovirus/drug effects
    • Dependovirus/physiology
    • Endocytosis/drug effects
    • Female
    • Gene Deletion
    • Genetic Therapy/methods
    • Host Specificity
    • Humans
    • Male
    • Mice
    • Parvoviridae Infections/metabolism
    • Parvoviridae Infections/virology
    • Receptors, Cell Surface/antagonists & inhibitors
    • Receptors, Cell Surface/deficiency
    • Receptors, Cell Surface/genetics
    • Receptors, Cell Surface/metabolism
    • Receptors, Virus/antagonists & inhibitors
    • Receptors, Virus/deficiency
    • Receptors, Virus/genetics
    • Receptors, Virus/metabolism
    • Viral Tropism/drug effects
    • Virus Internalization/drug effects
    • trans-Golgi Network/drug effects
    Strain GQC Summary
    Coisogenic strain carrying the em1Janc allele of the AU040320 gene on FVB/NCrl background. FVB/NCrl was detected with diagnostic alleles. The genome of this strain is fully replicable. This GQC report is based on the MiniMUGA G3 2024 pipeline using 2 samples genotyped in 2019.
    MMRRC Strain GQC Report
    Suggested Control Mice
    Littermates of all relevant genotypes.
    • Research Tools
    • Virology
    Donor
    Jan Carette, Ph.D., Stanford University School of Medicine.
    Primary Reference

    Pillay S, Meyer NL, Puschnik AS, Davulcu O, Diep J, Ishikawa Y, Jae LT, Wosen JE, Nagamine CM, Chapman MS, Carette JE. An essential receptor for adeno-associated virus infection. Nature. 2016 Feb 4;530(7588):108-12. doi: 10.1038/nature16465. Epub 2016 Jan 27. Erratum in: Nature. 2016 Nov 17;539(7629):456. (Medline PMID: 26814968)

    Additional References

    Pillay S, Meyer NL, Puschnik AS, Davulcu O, Diep J, Ishikawa Y, Jae LT, Wosen JE, Nagamine CM, Chapman MS, Carette JE. Corrigendum: An essential receptor for adeno-associated virus infection. Nature. 2016 Nov 17;539(7629):456. doi: 10.1038/nature19835. Epub 2016 Sep 28. Erratum for: Nature. 2016 Feb 4;530(7588):108-12. (Medline PMID: 27680708)

    Strain Development
    Generated at a contract facility (Cyagen Biosciences, Inc.) using FVB/N embryos.


    Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
    Coat Color
    white
    Other
    none
    MMRRC Breeding System
    Random intra-strain mating
    Generation
    N/A
    Overall Breeding Performance
    Excellent
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: 6 to 8 months 6 to 8 months
    Bred to Homozygosity
    No
    Average litter size
    5-9
    Recommended wean age
    3 weeks

    Order Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The submitter or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    043535-UCD-EMBRYO Cryo-preserved embryos $1,038.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
    043535-UCD-SPERM Cryo-preserved spermatozoa $546.25 / Non-Profit Aliquot Approximate quantity3
    043535-UCD-RESUS Litter recovered from cryo-archive $5,892.91 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.