Strain Name:
C57BL/6NJ-Wdr41em1(IMPC)J/Mmjax
Stock Number:
043720-JAX
Citation ID:
RRID:MMRRC_043720-JAX
Major Collection:

Gene Information

Wdr41em1(IMPC)J
Name: WD repeat domain 41; endonuclease-mediated mutation 1, Jackson
Type: Allele
Species: Mus musculus (mouse)
Alteration at locus: CRISPR
Wdr41
Name: WD repeat domain 41
Synonyms: MSTP048, B830029I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: CRISPR
NCBI: 218460
Homologene: 23087
Genetic Alterations
intragenic deletion
Genotype Determination
Phenotype
Phenotyping data may be available at mousephenotype.org.
Mammalian Phenotype Terms
Allelic Composition: (Genetic Background: )

  • adipose tissue
    • decreased total body fat amount []
  • behavior/neurological
    • hyperactivity []
Strain Development
This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAATACATACCAGTTCTACA, GGCCCAGTAGTTTTAAAGTC, TAAATGCTACAATTTTCAGT and TCTTTGTCAGCATTGACCAC, which resulted in a 391 bp deletion beginning at Chromosome 13 positive strand position 94,978,329 bp and ending after 94,978,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262273 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 96 bp before the 391 bp deletion there are 2 small intronic indels, a 5 bp (GTTGA) insertion followed 8 bp after that insertion by an 11 bp deletion (GTAGTTTTAAA) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 17 and early truncation 6 amino acids later.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
Donor
Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org .
Coat Color
black
Generation
N2F2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined Undetermined
Heterozygotes are fertile: Undetermined Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.